Following is the list of genetic conditions that we can currently test for. Click on each one for further information (this is primarily for your physician). It may be possible to test for specicidic diagnositic test for other genetic conditions not in the list given below. If the conditioon you are looking for does not appear below, please contact us for more information.
Methylbutyryl Glycinuria
Condition Gene/ Varient
Methylbutyryl Gene:HMGCL. Exons: NM_000191.2:1-9. Variants(2): c.835G>A
Glycinuria c.122G>A
Hydroxy-3-methylglutaryl-CoA lyase deficiency
Condition Gene/Varient
Hydroxy-3-methylglutaryl-CoA lyase deficiency Gene:HMGCL. Exons: NM_000191.2:1-9. Variants(2): c.835G>A, c.122G>A
Hydroxyisobutryl-CoA Hydrolase Deficiency
Condition Gene/Varient
Hydroxyisobutryl-CoA Hydrolase Deficiency Gene:HIBCH. Exons: NM_014362.3:1-14. Variants(3): c.365A>G, c.220-9T>G, c.79- 3C>G
Methylcrotonyl-CoA Carboxylase 1 Deficiency
Condition Gene/Varient
Methylcrotonyl-CoA Carboxylase 1 Deficiency Gene:MCCC1. Exons: NM_020166.3:1-19. Variants(4): c.1310T>C, c.2079delA, c.1594G>C, c.1380T>G
Methylcrotonyl-CoA Carboxylase 2 Deficiency
Condition Gene/Varient
Methylcrotonyl-CoA Carboxylase 2 Deficiency Gene:MCCC2. Exons: NM_022132.4:1-17. Variants(7): c.464G>A, c.295G>C, c.517_518insT, c.929C>G, c.1015G>A, c.803G>C, c.838G>T
Methylglutaconic Aciduria Type 1
Condition Gene/Varient
Methylglutaconic Aciduria Type 1 Gene:AUH. Exons: NM_001698.2:1-10. Variants(5): c.589C>T, c.559G>A, c.991A>T, c.895- 1G>A, c.650G>A
Methylglutaconic Aciduria Type 31
Condition Gene/Varient
Methylglutaconic Aciduria Type 3 Gene:OPA3. Exons: NM_025136.3:1-2. Variants(1): c.143-1G>C 3
Methylglutaconic Aciduria Type 5
Condition Gene/Varient
Methylglutaconic Aciduria Type 5 Gene:DNAJC19. Exons: NM_145261.3:1-6. Variants(1): c.130-1G>C
ABCC8-Related Congenital Hyperinsulinism
Condition Gene/Varient
ABCC8-Related Congenital Hyperinsulinism Gene:ABCC8. Exons: NM_000352.3:1-39. Variants(5): c.3989-9G>A, c.560T>A, c.2147G>T, c.4160_4162delTCT, c.4307G>A
ABCD Syndrome
Condition Gene/Varient
ABCD Syndrome Gene:EDNRB. Exons: NM_000115.3:2-8. Variants(1): c.601C>T
Abetalipoproteinemia
Condition Gene/Varient
Abetalipoproteinemia Gene:MTTP. Exons: NM_000253.2:2-19. Variants(3): c.1769G>T, c.1619G>A, c.2593G>T
ACAD9 deficiency
Condition Gene/Varient
ACAD9 deficiency Gene:ACAD9. Exons: NM_014049.4:1-18. Variants(4): c.1594C>T, c.130T>A, c.1249C>T, c.797G>A
ACE-Related Renal Tubular Dysgenesis
Condition Gene/Varient
ACE-Related Renal Tubular Dysgenesis Gene:ACE. Exons: NM_000789.3:2-25. Variants(4): c.1486C>T, c.1319_1322delTGGA, c.798C>G, c.2371C>T A
Achondrogenesis Type 1B
Condition Gene/Varient
Achondrogenesis Type 1B Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1020_1022delTGT, c.1273A>G, c.532C>T, c.2033G>T
Acrocallosal Syndrome
Condition Gene/Varient
Acrocallosal Syndrome Gene:KIF7. Exons: NM_198525.2:2-4,6-19. Variants(3): c.687delG, c.3001C>T, c.460C>T
Acyl-CoA Dehydrogenase Deficiency,Medium-Chain
Condition Gene/Varient
Acyl-CoA Dehydrogenase Deficiency,Medium-Chain Gene:ACADM. Exons: NM_000016.4:1-12. Variants(2): c.199T>C, c.985A>G Acyl-CoA
Dehydrogenase Deficiency,Very Long-Chain
Condition Gene/Varient
Dehydrogenase Deficiency,Very Long-Chain Gene:ACADVL. Exons: NM_000018.3:1-20. Variants(3): c.779C>T, c.848T>C, c.1322G>A
Adenosine Deaminase Deficiency
Condition Gene/Varient
Adenosine Deaminase Deficiency Gene:ADA. Exons: NM_000022.2:2-12. Variants(4): c.632G>A, c.226C>T, c.986C>T, c.320T>C
AGTR1-Related Renal Tubular Dysgenesis
Condition Gene/Varient
AGTR1-Related Renal Tubular Dysgenesis Deficiency Gene:AGTR1. Exons: NM_031850.3:3-4. Variants(1): c.215dupT
AGT-Related Renal Tubular Dysgenesis
Condition Gene/Varient
AGT-Related Renal Tubular Dysgenesis Gene:AGT. Exons: NM_000029.3:2-5. Variants(2): c.604C>T, c.1290delT
Aicardi-goutières Syndrome 1
Condition Gene/Varient
Aicardi-goutières Syndrome 1 Gene:TREX1. Exons: NM_033629.3:2. Variants(2): c.490C>T, c.341G>A
AICA-ribosiduria due to ATIC deficiency
Condition Gene/Varient
AICA-ribosiduria due to ATIC deficiency Gene:ATIC. Exons: NM_004044.6:2-16. Variants(1): c.1277A>G
Alkaptonuria
Condition Gene/Varient
Alkaptonuria Gene:HGD. Exons: NM_000187.3:1-14. Variants(11): c.688C>T, c.457_458insG, c.1111_1112insC, c.342+1G>A, c.808G>A, c.899T>G, c.175delA, c.1102A>G, c.360T>G, c.16-1G>A, c.481G>A
Alpha-Mannosidosis
Condition Gene/Varient
Alpha-Mannosidosis Gene:MAN2B1. Exons: NM_000528.3:1-24. Variants(7): c.215A>T, c.1067C>G, c.1830+1G>C, c.1915C>T, c.2278C>T, c.2426T>C, c.2248C>T
Alpha-Methylacyl-CoA Racemase Deficiency
Condition Gene/Varient
Alpha-Methylacyl-CoA Racemase Deficiency Gene:AMACR. Exons: NM_014324.5:1-5. Variants(1): c.154T>C
Alpha-thalassemia
Condition Gene/Varient
Alpha-thalassemia Gene:HBA1/HBA2. Variants(5): aa/-a3.7, aa/-a4.2, aa/-aSEA, aa/-aFIL, aa/-aTHAI
Alstrom Syndrome
Condition Gene/Varient
Alstrom Syndrome Gene:ALMS1. Exons: NM_015120.4:2-23. Variants(6): c.11449C>T, c.11316_11319delAGAG, c.8164C>T, c.8383C>T, c.10775delC, c.10483C>T
AMT-Related Glycine Encephalopathy
Condition Gene/Varient
AMT-Related Glycine Encephalopathy Gene:AMT. Exons: NM_000481.3:1-9. Variants(3): c.125A>G, c.139G>A, c.959G>A
Androgen Insensitivity Syndrome
Condition Gene/Varient
Androgen Insensitivity Syndrome Gene:AR. Exons: NM_000044.3:2-8. Variants(10): c.2650A>T, c.1769-11T>A, c.521T>G, c.2395C>G, c.340C>T, c.4G>A, c.1771A>T, c.2391G>A, c.2567G>A, c.2157G>A
Arginase Deficiency
Condition Gene/Varient
Arginase Deficiency Gene:ARG1. Exons: NM_000045.3:1-8. Variants(7): c.365G>A, c.871C>T, c.703G>C, c.413G>T, c.32T>C, c.869C>G, c.61C>T
Argininosuccinic Aciduria
Condition Gene/Varient
Argininosuccinic Aciduria Gene:ASL. Exons: NM_000048.3:2-17. Variants(8): c.35G>A, c.1060C>T, c.857A>G, c.1135C>T, c.532G>A, c.346C>T, c.1153C>T, c.283C>T
Aromatic L-Amino Acid Decarboxylase Deficiency
Condition Gene/Varient
Aromatic L-Amino Acid Decarboxylase Deficiency Gene:DDC. Exons: NM_000790.3:2-14. Variants(2): c.749C>T, c.304G>A
Arthrogryposis-Renal Dysfunction-Cholestasis 1
Condition Gene/Varient
Arthrogryposis-Renal Dysfunction-Cholestasis 1 Gene:VPS33B. Exons: NM_018668.3:1-23. Variants(3): c.1594C>T, c.89T>C, c.1312C>T
Aspartylglucosaminuria
Condition Gene/Varient
Aspartylglucosaminuria Gene:AGA. Exons: NM_000027.3:1-9. Variants(5): c.302C>T, c.488G>C, c.214T>C, c.904G>A, c.800dupT
Ataxia With Oculomotor Apraxia Type 1
Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 1 Gene:APTX. Exons: NM_175073.2:3-9. Variants(7): c.837G>A, c.875-1G>A, c.788T>G, c.602A>G, c.167delT, c.320delC, c.617C>T
Ataxia With Oculomotor Apraxia Type 2
Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 2 Gene:SETX. Exons: NM_015046.5:3-26. Variants(7): c.6638C>T, c.3880C>T, c.5927T>G, c.1027G>T, c.994C>T, c.2602C>T, c.4087C>T
Ataxia With Vitamin E Deficiency
Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 2 Gene:TTPA. Exons: NM_000370.3:25. Variants(5): c.485delG, c.513_514insTT, c.400C>T
Ataxia, Posterior Column, With Retinitis Pigmentosa
Condition Gene/Varient
Ataxia, Posterior Column, With Retinitis Pigmentosa Gene:FLVCR1. Exons: NM_014053.3:1-10. Variants(4): c.1477G>C, c.721G>A, c.361A>G, c.574T>C
Ataxia-telangiectasia
Condition Gene/Varient
Ataxia-telangiectasia Gene:ATM. Exons: NM_000051.3:2-63. Variants(11): c.7517_7520delGAGA, c.7967T>C, c.8030A>G, c.9139C>T, c.8480T>G, c.3245_3247delATCinsTGAT, c.103C>T, c.7875_7876delTGinsGC, c.5932G>T, c.5908C>T, c.3576G>A
Atelosteogenesis Type 2
Condition Gene/Varient
Atelosteogenesis Type 2 Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1535C>A, c.835C>T, c.764G>A, c.2144C>T
ATP7A-Related Copper Transport Disorders
Condition Gene/Varient
ATP7A-Related Copper Transport Disorders Gene:ATP7A. Exons: NM_000052.5:2-23. Variants(7): c.3911A>G, c.601C>T, c.1910C>T, c.2938C>T, c.4156C>T, c.2981C>T, c.3056G>A
Autoimmune Polyendocrine Syndrome Type 1
Condition Gene/Varient
Autoimmune Polyendocrine Syndrome Type 1 Gene:AIRE. Exons: NM_000383.3:1-11,13-14. Variants(8): c.239T>G, c.1103_1104insC, c.247A>G, c.415C>T, c.1513delG, c.769C>T, c.254A>G, c.789delC
Autosomal Recessive Deafness 12
Condition Gene/Varient
Autosomal Recessive Deafness 12 Gene:CDH23. Exons: NM_022124.5:2-70. Variants(5): c.4021G>A, c.719C>T, c.902G>A, c.6442G>A, c.5663T>C
Autosomal Recessive Deafness 1A
Condition Gene/Varient
Autosomal Recessive Deafness 1A Gene:GJB2. Exons: NM_004004.5:2. Variants(58): c.340G>T, c.195C>G, c.134G>A, c.71G>A, c.533T>C, c.231G>A, c.56G>C, c.139G>T, c.416G>A, c.647_650delGATA, c.427C>T, c.35_36insC, c.268C>G, c.59T>C, c.358_360delGAG, c.269T>C, c.476A>T, c.617A>G, c.299_300delAT, c.334_335delAA, c.641T>C, c.408C>A, c.370C>T, c.638T>A, c.290_291insT, c.229T>C, c.398G>A, c.230G>A, c.614T>C, c.132G>A, c.283G>A, c.550C>T, c.523C>A, c.167delT, c.633T>A, c.44A>C, c.504_505insCCTT, c.572delT, c.94C>T, c.246C>G, c.508_509insT, c.169C>T, c.250G>C, c.119C>A, c.508_511dupAACG, c.428G>A, c.176_191delGCTGCAAGAACGTGTG, c.363delC, c.279G>A, c.516G>A, c.148G>A, c.439G>A, c.235delC, c.270dupA, c.518C>G, c.598G>A, c.1A>G, c.35delG
Autosomal Recessive Deafness 2
Condition Gene/Varient
Autosomal Recessive Deafness 2 Gene:MYO7A. Exons: NM_000260.3:2-49. Variants(5): c.1797G>A, c.133-2A>G, c.1184G>A, c.731G>C, c.3596dupT
Autosomal Recessive Deafness 21
Condition Gene/Varient
Autosomal Recessive Deafness 21 Gene:TECTA. Exons: NM_005422.2:1-23. Variants(3): c.6037delG, c.2941+1G>A, c.651_652insC
Autosomal Recessive Deafness 22
Condition Gene/Varient
Autosomal Recessive Deafness 22 Gene:OTOA. Exons: NM_144672.3:1-19. Variants(1): c.1320+2T>C
Autosomal Recessive Deafness 23
Condition Gene/Varient
Autosomal Recessive Deafness 23 Gene:PCDH15. Exons: NM_033056.3:2-33. Variants(3): c.785G>A, c.400C>G, c.1583T>A
Autosomal Recessive Deafness 24
Condition Gene/Varient
Autosomal Recessive Deafness 24 Gene:RDX. Exons: NM_002906.3:2-14. Variants(3): c.1405dupG, c.1732G>A, c.463C>T
Autosomal Recessive Deafness 25
Condition Gene/Varient
Autosomal Recessive Deafness 25 Gene:GRXCR1. Exons: NM_001080476.2:1-4. Variants(4): c.628-9C>A, c.412C>T, c.627+19A>T, c.229C>T
Autosomal Recessive Deafness 28
Condition Gene/Varient
Autosomal Recessive Deafness 28 Gene:TRIOBP. Exons: NM_001039141.2:3-6,8-17,19,21-23. Variants(6): c.3349C>T, c.1039C>T, c.2362C>T, c.1741C>T, c.889C>T, c.3202C>T
Autosomal Recessive Deafness 29
Condition Gene/Varient
Autosomal Recessive Deafness 29 Gene:CLDN14. Exons: NM_144492.2:3. Variants(3): c.254T>A, c.398delT, c.301G>A
Autosomal Recessive Deafness 3
Condition Gene/Varient
Autosomal Recessive Deafness 3 Gene:MYO15A. Exons: NM_016239.3:3-66. Variants(9): c.10573delA, c.8789-1G>C, c.5492G>T, c.3313G>T, c.3336delG, c.9958_9961delGACT, c.3756+1G>T, c.8148G>T, c.3685C>T
Autosomal Recessive Deafness 30
Condition Gene/Varient
Autosomal Recessive Deafness 30 Gene:MYO3A. Exons: NM_017433.4:3-35. Variants(3): c.1777-12G>A, c.732-2A>G, c.3129T>G
Autosomal Recessive Deafness 35
Condition Gene/Varient
Autosomal Recessive Deafness 35 Gene:ESRRB. Exons: NM_004452.3:4-11. Variants(2): c.1018_1024dupGAGTTTG, c.1024G>T
Autosomal Recessive Deafness 37
Condition Gene/Varient
Autosomal Recessive Deafness 37 Gene:MYO6. Exons: NM_004999.3:2-35. Variants(3): c.647A>T, c.3496C>T, c.36dupT
Autosomal Recessive Deafness 39
Condition Gene/Varient
Autosomal Recessive Deafness 39 Gene:HGF. Exons: NM_000601.4:1-18. Variants(1): c.495G>A
Autosomal Recessive Deafness 4, with Enlarged Vestibular Aqueduct
Condition Gene/Varient
Autosomal Recessive Deafness 4, with Enlarged Vestibular Aqueduct Gene:SLC26A4. Exons: NM_000441.1:3-21. Variants(94): c.1803G>A, c.2219G>T, c.1334T>G, c.1341+1delG, c.322delC, c.919-2A>G, c.2228T>A, c.1595G>T, c.916dupG, c.170C>A, c.1863delT, c.2168A>G, c.941C>A, c.1001+1G>A, c.281C>T, c.783_784insT, c.754T>C, c.2089+1G>A, c.440T>C, c.1160C>T, c.415+7A>G, c.1226G>A, c.1151A>G, c.1614+1G>A, c.2027T>A, c.1337A>G, c.1363A>T, c.1172G>A, c.2343A>G, c.1707+5G>A, c.589G>A, c.1246A>C, c.1409G>A, c.2173G>C, c.753_756delCTCT, c.1174A>T, c.365_366insT, c.304G>A, c.1198delT, c.1343C>T, c.707T>C, c.1588T>C, c.1229C>T, c.1615-1G>A, c.1975G>C, c.397T>A, c.626G>T, c.2080T>C, c.233A>G, c.1919G>A, c.395C>T, c.1105A>G, c.1541A>G, c.1589A>C, c.1149+3A>G, c.1079C>T, c.2127delT, c.2086C>T, c.1147delC, c.946G>T, c.-3-2A>G, c.230A>T, c.1392delG, c.1264-1G>C, c.165-1G>A, c.412G>T, c.716T>A, c.1667A>G, c.601-1G>A, c.918+1G>A, c.279T>A, c.1439T>A, c.2162C>T, c.1694G>A, c.1334_1335insAGTC, c.1371C>A, c.235C>T, c.2170G>A, c.407_411delTCTCA, c.2015G>A, c.665G>T, c.1985G>A, c.249G>A, c.269C>T, c.1536_1537delAG, c.890delC, c.2186T>C, c.279delT, c.129dupC, c.149T>G, c.68C>A, c.84C>A, c.85G>C, c.87G>C
Autosomal Recessive Deafness 49
Condition Gene/Varient
Autosomal Recessive Deafness 49 Gene:MARVELD2. Exons: NM_001038603.2:2-7. Variants(5): c.1331+1G>A, c.1183-1G>A, c.1498C>T, c.1331+2T>C, c.1331+2_1331+5delTGAG
Autosomal Recessive Deafness 59
Condition Gene/Varient
Autosomal Recessive Deafness 59 Gene:DFNB59. Exons: NM_001042702.3:2-7. Variants(7): c.988delG, c.726delT, c.161C>T, c.547C>T, c.499C>T, c.122delA, c.113dupT
Autosomal Recessive Deafness 6
Condition Gene/Varient
Autosomal Recessive Deafness 6 Gene:TMIE. Exons: NM_147196.2:2-4. Variants(3): c.170G>A, c.241C>T, c.250C>T
Autosomal Recessive Deafness 61
Condition Gene/Varient
Autosomal Recessive Deafness 61 Gene:SLC26A5. Exons: NM_198999.2:3-20. Variants(3): c.390A>C, c.209G>A, c.-53-2A>G
Autosomal Recessive Deafness 63
Condition Gene/Varient
Autosomal Recessive Deafness 63 Gene:LRTOMT. Exons: NM_001145308.4:3-7. Variants(5): c.242G>A, c.313T>C, c.333C>G, c.328G>A, c.358+4A>C
Autosomal Recessive Deafness 67
Condition Gene/Varient
Autosomal Recessive Deafness 67 Gene:LHFPL5. Exons: NM_182548.3:1-3. Variants(4): c.250delC, c.380A>G, c.649delG, c.494C>T
Autosomal Recessive Deafness 7/11
Condition Gene/Varient
Autosomal Recessive Deafness 7/11 Gene:TMC1. Exons: NM_138691.2:5-24. Variants(4): c.1543T>C, c.1960A>G, c.1165C>T, c.100C>T
Autosomal Recessive Deafness 77
Condition Gene/Varient
Autosomal Recessive Deafness 77 Gene:LOXHD1. Exons: NM_144612.6:1-40. Variants(2): c.4714C>T, c.2008C>T
Autosomal Recessive Deafness 79
Condition Gene/Varient
Autosomal Recessive Deafness 79 Gene:TPRN. Exons: NM_001128228.2:2-4. Variants(2): c.1427delC, c.1239G>A T
Autosomal Recessive Deafness 8/10
Condition Gene/Varient
Autosomal Recessive Deafness 8/10 Gene:TMPRSS3. Exons: NM_024022.2:2-13. Variants(4): c.647G>T, c.753G>C, c.208delC, c.1211C>T
Autosomal Recessive Deafness 9
Condition Gene/Varient
Autosomal Recessive Deafness 9 Gene:OTOF. Exons: NM_194248.2:1-46. Variants(8): c.1544T>C, c.3032T>C, c.1778delT, c.766- 2A>G, c.2485C>T, c.2348delG, c.4491T>A, c.5816G>A
Autosomal Recessive Distal Spinal Muscular Atrophy 1
Condition Gene/Varient
Autosomal Recessive Distal Spinal Muscular Atrophy 1 Gene:IGHMBP2. Exons: NM_002180.2:2-15. Variants(7): c.675delT, c.638A>G, c.1738G>A, c.121C>T, c.2362C>T, c.707T>G, c.2611+1G>T
Autosomal Recessive Distal Spinal Muscular Atrophy 4
Condition Gene/Varient
Autosomal Recessive Distal Spinal Muscular Atrophy 4 Gene:PLEKHG5. Exons: NM_020631.4:2-21. Variants(1): c.1940T>C
Autosomal Recessive Hypophosphatemic Rickets 1
Condition Gene/Varient
Autosomal Recessive Hypophosphatemic Rickets 1 Gene:DMP1. Exons: NM_004407.3:2-6. Variants(3): c.362delC, c.1A>G, c.55-1G>C
Autosomal Recessive Hypophosphatemic Rickets 2
Condition Gene/Varient
Autosomal Recessive Hypophosphatemic Rickets 2 Gene:ENPP1. Exons: NM_006208.2:2-25. Variants(2): c.2702A>C, c.797G>T C
Autosomal Recessive Neutropenia, Severe Congenital 4
Condition Gene/Varient
Autosomal Recessive Neutropenia, Severe Congenital 4 Gene:G6PC3. Exons: NM_138387.3:1-6. Variants(7): c.778G>C, c.758G>A, c.346A>G, c.141C>G, c.935_936insT, c.784G>C, c.554T>C
Autosomal Recessive Osteopetrosis 1
Condition Gene/Varient
Autosomal Recessive Osteopetrosis 1 Gene:TCIRG1. Exons: NM_006019.3:2-20. Variants(4): c.2236+1G>A, c.1331G>T, c.1213G>A, c.1392C>A
Autosomal Recessive Osteopetrosis 3
Condition Gene/Varient
Autosomal Recessive Osteopetrosis 3 Gene:CA2. Exons: NM_000067.2:2-7. Variants(3): c.232+1G>A, c.120T>G, c.319C>T
Autosomal Recessive Osteopetrosis 4
Condition Gene/Varient
Autosomal Recessive Osteopetrosis 4 Gene:CLCN7. Exons: NM_001287.5:2-25. Variants(3): c.2285G>A, c.1663C>T, c.2297T>C
Autosomal Recessive Osteopetrosis 5
Condition Gene/Varient
Autosomal Recessive Osteopetrosis 5 Gene:OSTM1. Exons: NM_014028.3:1-6. Variants(1): c.415_416delAG C
Autosomal Recessive Polycystic Kidney Disease
Condition Gene/Varient
Autosomal Recessive Polycystic Kidney Disease Gene:PKHD1. Exons: NM_138694.3:2-67. Variants(137): c.8579_8583delACAGT, c.711_714delAATG, c.1626_1629delACTT, c.9464A>G, c.10412T>G, c.10219C>T, c.528-2A>G, c.5323C>T, c.10136delC, c.8068T>C, c.10765C>T, c.5378_5380+1delATGG, c.737T>C, c.2269A>C, c.8588A>G, c.9707delC, c.4330C>T, c.10628_10635delTGTATGTT, c.6333-2A>G, c.10658T>C, c.1057C>T, c.2810G>A, c.3467C>T, c.5895dupA, c.8312T>A, c.2936C>T, c.1880T>A, c.2542T>A, c.982C>T, c.1095G>A, c.9348delG, c.5498C>T, c.6992T>A, c.9689delA, c.5993T>C, c.10728G>A, c.9765G>A, c.3306delT, c.2532C>A, c.7477C>T, c.3848C>A, c.664A>G, c.977G>T, c.7177C>T, c.9319C>T, c.5485C>T, c.10856delA, c.3958_3959delGG, c.4256_4257delGG, c.10637delT, c.5375delT, c.474G>A, c.3367G>A, c.6097A>G, c.6029delA, c.9861C>A, c.2279G>A, c.10240delA, c.6907A>T, c.107C>T, c.11074C>T, c.10364delC, c.11506+1G>A, c.9683C>A, c.3118C>T, c.2341C>T, c.11612G>A, c.8302+2T>C, c.1486C>T, c.383delC, c.5750A>C, c.10972_10973delAT, c.6209G>A, c.2520_2526delATACACT, c.7264T>G, c.8829_8830insG, c.5748_5749delTC, c.10031T>G, c.8011C>T, c.10077delG, c.1411_1412delGT, c.11524C>T, c.10637_10638insG, c.9718C>T, c.10444C>T, c.7916C>A, c.2264C>T, c.10174C>T, c.9719G>A, c.9239G>A, c.8909_8912delTTGT, c.8642+1G>A, c.7912-1G>C, c.8870T>C, c.3761_3762delCCinsG, c.2216C>T, c.7351-2A>T, c.53-3C>A, c.3229-2A>C, c.1418T>G, c.6929delG, c.2141-1G>T, c.881-1G>A, c.4870C>T, c.977-1G>A, c.4457C>T, c.5075G>A, c.9530T>C, c.353delG, c.2854G>A, c.5646delT, c.1690C>T, c.370C>T, c.5513A>G, c.2812_2813delTA, c.6296_6297delTG, c.8518C>T, c.1233+1G>A, c.8935C>T, c.5381-2A>C, c.3747T>G, c.9347delT, c.4220T>G, c.6383delT, c.976+2T>A, c.1937G>A, c.8114delG, c.5825A>G, c.9370C>T, c.4751G>T, c.1774C>T, c.5237-1G>A, c.1830T>A, c.2179_2180insT, c.3364G>A, c.10709C>G, c.8824C>T
Autosomal Recessive Segawa Syndrome
Condition Gene/Varient
Autosomal Recessive Segawa Syndrome Gene:TH. Exons: NM_000360.3:1-13. Variants(6): c.605G>A, c.614T>C, c.1388C>T, c.917G>A, c.1141C>A, c.733A>C
Autosomal Recessive Spastic Ataxia of Charlevoix-Saguenay
Condition Gene/Varient
Autosomal Recessive Spastic Ataxia of Charlevoix-Saguenay Gene:SACS. Exons: NM_014363.4:2,4-10. Variants(4): c.8844delT, c.7504C>T, c.12160C>T, c.10907G>A
Autosomal Recessive Spastic paraplegia 11
Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 11 Gene:SPG11. Exons: NM_025137.3:1-40. Variants(8): c.6100C>T, c.733_734delAT, c.7152- 1G>C, c.5623C>T, c.2472_2473insT, c.529_533delATATT, c.442+1G>C, c.118C>T
Autosomal Recessive Spastic paraplegia 15
Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 15 Gene:ZFYVE26. Exons: NM_015346.3:2-42. Variants(4): c.5485-1G>A, c.5422C>T, c.4312C>T, c.1477C>T
Autosomal Recessive Spastic paraplegia 20
Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 20 Gene:SPG20. Exons: NM_015087.4:2-9. Variants(2): c.364_365delAT, c.1110delA
Autosomal Recessive Spastic paraplegia 7
Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 7 Gene:SPG7. Exons: NM_003119.2:2-17. Variants(10): c.1617delC, c.2216_2217insA, c.1045G>A, c.1529C>T, c.1749G>C, c.1742_1744delTGG, c.850_851delTTinsC, c.233T>A, c.784_785delGC, c.2075G>C
Bardet-Biedl syndrome 1
Condition Gene/Varient
Bardet-Biedl syndrome 1 Gene:BBS1. Exons: NM_024649.4:1-17. Variants(1): c.1169T>G Bardet-Biedl syndrome 10. Gene:BBS10. Exons: NM_024685.3:1-2. Variants(1): c.217_218insT
Bartter Syndrome Type 1
Condition Gene/Varient
Bartter Syndrome Type 1 Gene:SLC12A1. Exons: NM_000338.2:2-27. Variants(3): c.1942G>A, c.814G>T, c.1875G>A Bartter Syndrome Type 2. Gene:KCNJ1. Exons: NM_000220.3:1-2. Variants(8): c.592G>A, c.641C>T, c.372T>A, c.500G>A, c.237C>G, c.657C>G, c.80G>A, c.322G>C
Bartter Syndrome Type 4A
Condition Gene/Varient
Bartter Syndrome Type 4A Gene:BSND. Exons: NM_057176.2:1-4. Variants(8): c.139G>A, c.28G>A, c.3G>A, c.35T>C, c.1A>T, c.23G>T, c.10G>T, c.22C>T
Bestrophinopathy
Condition Gene/Varient
Bestrophinopathy Gene:BEST1. Exons: NM_004183.3:2-11. Variants(4): c.422G>A, c.122T>C, c.949G>A, c.598C>T
Beta-Ketothiolase Deficiency
Condition Gene/Varient
Beta-Ketothiolase Deficiency Gene:ACAT1. Exons: NM_000019.3:1-12. Variants(11): c.433C>G, c.2T>A, c.935T>C, c.1083dupA, c.997G>C, c.814C>T, c.1136G>T, c.547G>A, c.1035_1037delAGA, c.1138G>A, c.278A>G T
Beta-thalassemia
Condition Gene/Varient
Beta-thalassemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(110): c.216_217insT, c.79G>A, c.170G>A, c.316-3C>A, c.20A>T, c.364G>A, c.316-106C>G, c.4delG, c.111_118delTTGGACCC, c.1A>G, c.27dupG, c.52A>T, c.19G>T, c.92+5G>C, c.226delC, c.59A>G, c.92+5G>T, c.212C>G, c.215_216insA, c.114_120delGACCCAG, c.93-1G>C, c.315+1G>A, c.176_177insC, c.113G>A, c.92+1G>T, c.316- 14T>G, c.110delC, c.22_24delGAG, c.92+2T>A, c.2T>A, c.3G>T, c.230delC, c.108C>A, c.74delGinsCAC, c.82G>T, c.165delT, c.94delC, c.316-2A>G, c.93-3T>G, c.316-146T>G, c.349_350insTGAT, c.17_18delCT, c.332T>C, c.68_74delAAGTTGG, c.316-2A>C, c.2T>G, c.112delT, c.316-197C>T, c.-50-u30T>A, c.25_26delAA, c.47G>A, c.92G>C, c.189_195delTCATGGC, c.2T>C, c.315+1G>T, c.93-21G>A, c.36delT, c.-50-u31A>G, c.77_79delGTG, c.19G>A, c.380T>G, c.85_86insC, c.322_323insC, c.48G>A, c.364G>C, c.-50-u29A>G, c.425_433delTGGCCCACA, c.138delT, c.316-7C>G, c.75T>A, c.315+2delT, c.-43C>T, c.20delA, c.54_59delGGTGAA, c.92+1G>A, c.316-1G>T, c.287_288insA, c.78dupT, c.114G>A, c.118C>T, c.92+2T>C, c.3G>C, c.*110_*111delTA, c.92+6T>C, c.28_29insTA, c.315+1G>C, c.93-2A>G, c.-50-u28A>G, c.-50-u87C>T, c.-29G>A, c.-50-u87C>G, c.380T>A, c.93-1G>A, c.*110T>C, c.203_204delTG, c.135delC, c.126_129delCTTT, c.79G>T, c.67G>T, c.143_146dupATCT, c.184A>T, c.-50A>C, c.235delC, c.3G>A, c.45dupG, c.93-2A>C, c.92+2T>G, c.92+5G>A, c.178A>T, c.217dupA
Bietti Crystalline Dystrophy
Condition Gene/Varient
Bietti Crystalline Dystrophy Gene:CYP4V2. Exons: NM_207352.3:2-11. Variants(2): c.327+1G>A, c.1091-2A>G
Biotinidase Deficiency
Condition Gene/Varient
Biotinidase Deficiency Gene:BTD. Exons: NM_000060.2:1-4. Variants(8): c.1612C>T, c.235C>T, c.100G>A, c.1595C>T, c.511G>A, c.755A>G, c.98_104delGCGGCTGinsTCC, c.1368A>C
Bjornstad Syndrome
Condition Gene/Varient
Bjornstad Syndrome Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(3): c.548G>A, c.103G>C, c.550C>T
Bloom syndrome
Condition Gene/Varient
Bloom syndrome Gene:BLM. Exons: NM_000057.2:2-22. Variants(1): c.2207_2212delATCTGAinsTAGATTC T
Bothnia Type Retinitis Pigmentosa
Condition Gene/Varient
Bothnia Type Retinitis Pigmentosa Gene:RLBP1. Exons: NM_000326.4:3-9. Variants(1): c.700C>T
Brittle Cornea Syndrome
Condition Gene/Varient
Brittle Cornea Syndrome Gene:ZNF469. Exons: NM_001127464.1:1-2. Variants(1): c.4174G>T
C3 deficiency
Condition Gene/Varient
C3 deficiency Gene:C3. Exons: NM_000064.2:1-41. Variants(5): c.1004-2A>T, c.2354+1G>A, c.3116dupT, c.1655G>A, c.1119+1G>T
Canavan Disease
Condition Gene/Varient
Canavan Disease Gene:ASPA. Exons: NM_000049.2:1-6. Variants(5): c.654C>A, c.433-2A>G, c.854A>C, c.693C>A, c.914C>A
CARASIL Syndrome
Condition Gene/Varient
CARASIL Syndrome Gene:HTRA1. Exons: NM_002775.4:2-9. Variants(4): c.1108C>T, c.904C>T, c.889G>A, c.754G>A
Carbamoylphosphate Synthetase I Deficiency
Condition Gene/Varient
Carbamoylphosphate Synthetase I Deficiency Gene:CPS1. Exons: NM_001875.4:1-38. Variants(5): c.130C>T, c.1631C>T, c.2945G>A, c.2359C>T, c.1010A>G
Carnitine Palmitoyltransferase I Deficiency
Condition Gene/Varient
Carnitine Palmitoyltransferase I Deficiency Gene:CPT1A. Exons: NM_001876.3:2-19. Variants(6): c.1493A>G, c.1361A>G, c.1079A>G, c.298C>T, c.2126G>A, c.1241C>T
Carnitine Palmitoyltransferase II Deficiency
Condition Gene/Varient
Carnitine Palmitoyltransferase II Deficiency Gene:CPT2. Exons: NM_000098.2:1-5. Variants(11): c.1657G>A, c.1891C>T, c.452G>A, c.520G>A, c.359A>G, c.1507C>T, c.1148T>A, c.680C>T, c.338C>T, c.1883A>C, c.370C>T
Carpenter Syndrome
Condition Gene/Varient
Carpenter Syndrome Gene:RAB23. Exons: NM_183227.1:2-7. Variants(1): c.434T>
A Cartilage-hair hypoplasia
Condition Gene/Varient
A Cartilage-hair hypoplasia Gene:RMRP. Exons: NR_003051.3:1. Variants(1): n.71A>G
CC2D2A-Related COACH Syndrome
Condition Gene/Varient
CC2D2A-Related COACH Syndrome Gene:CC2D2A. Exons: NM_001080522.2:3-38. Variants(1): c.3145C>T
Central Core Disease
Condition Gene/Varient
Central Core Disease Gene:RYR1. Exons: NM_000540.2:1-90,92-106. Variants(2): c.14545G>A, c.10579C>T
Cerebral Dysgenesis, Neuropathy, Ichthyosis, And Palmoplantar Keratoderma Syndrome
Condition Gene/Varient
Cerebral Dysgenesis, Neuropathy, Ichthyosis, And Palmoplantar Keratoderma Gene:SNAP29. Exons: NM_004782.3:1- 5. Variants(1): c.487dupA
Cerebrooculofacioskeletal Syndrome 1
Condition Gene/Varient
Cerebrooculofacioskeletal Syndrome 1 Gene:ERCC6. Exons: NM_000124.2:2-21. Variants(2): c.2047C>T, c.3862C>T
Cerebrotendinous xanthomatosis
Condition Gene/Varient
Cerebrotendinous xanthomatosis Gene:CYP27A1. Exons: NM_000784.3:1-9. Variants(6): c.1435C>G, c.1016C>T, c.1421G>A, c.1420C>T, c.434G>A, c.1214G>A
Charcot-Marie-Tooth disease Type 1F/Type 2E
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 1F/Type 2E Gene:NEFL. Exons: NM_006158.3:1-4. Variants(2): c.628G>T, c.418G>T
Charcot-Marie-Tooth disease Type 2B1
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 2B1 Gene:LMNA. Exons: NM_170707.3:1-12. Variants(1): c.892C>T
Charcot-Marie-Tooth disease Type 2B2
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 2B2 Gene:MED25. Exons: NM_030973.3:1-18. Variants(1): c.1004C>T
Charcot-Marie-Tooth disease Type 4A
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4A Gene:GDAP1. Exons: NM_018972.2:1-6. Variants(5): c.581C>G, c.92G>A, c.715C>T, c.844C>T, c.487C>T
Charcot-Marie-Tooth disease Type 4B1
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4B1 Gene:MTMR2. Exons: NM_016156.5:1-15. Variants(3): c.1276C>T, c.826G>T, c.1444C>T
Charcot-Marie-Tooth disease Type 4B2
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4B2 Gene:SBF2. Exons: NM_030962.3:2-40. Variants(3): c.1459C>T, c.3586C>T, c.2875C>T
Charcot-Marie-Tooth disease Type 4C
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4C Gene:SH3TC2. Exons: NM_024577.3:1-17. Variants(20): c.2710C>T, c.530-2A>G, c.3325C>T, c.3341delC, c.1982T>C, c.2829T>G, c.1178-1G>A, c.1747_1748delAG, c.3601C>T, c.217_227delGCTGCTCGGAGinsCCAGTAA, c.505T>C, c.2860C>T, c.2491_2492delAG, c.920G>A, c.1969G>A, c.3326G>C, c.1586G>A, c.2191delG, c.28delG, c.1972C>T
SectionCharcot-Marie-Tooth disease Type 4D
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4D Gene:NDRG1. Exons: NM_006096.3:2-16. Variants(2): c.442C>T, c.538-1G>A
Charcot-Marie-Tooth disease Type 4F
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4F Gene:PRX. Exons: NM_181882.2:4-7. Variants(5): c.2098delG, c.2145T>A, c.3208C>T, c.1951G>A, c.586C>T
Charcot-Marie-Tooth disease Type 4H
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4H Gene:FGD4. Exons: NM_139241.2:3-17. Variants(7): c.823C>T, c.893T>G, c.670C>T, c.1628_1629delAG, c.1756G>T, c.1325G>A, c.893T>C
Charcot-Marie-Tooth disease Type 4J
Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4J Gene:FIG4. Exons: NM_014845.5:1-23. Variants(2): c.547C>T, c.122T>C
Chorea-Acanthocytosis
Condition Gene/Varient
Chorea-Acanthocytosis Gene:VPS13A. Exons: NM_033305.2:1-72. Variants(2): c.269T>A, c.622C>T
Citrullinemia Type I
Condition Gene/Varient
Citrullinemia Type I Gene:ASS1. Exons: NM_000050.4:3-16. Variants(13): c.910C>T, c.1085G>T, c.421-2A>G, c.970G>A, c.40G>A, c.794G>A, c.1168G>A, c.257G>A, c.835C>T, c.539G>A, c.470G>A, c.970+5G>A, c.1087C>T
Citrullinemia Type II
Condition Gene/Varient
Citrullinemia Type II Gene:SLC25A13. Exons: NM_014251.2:1-18. Variants(12): c.674C>A, c.1078C>T, c.852_855delTATG, c.1799dupA, c.1311+1G>A, c.615+1G>C, c.1801G>T, c.615+5G>A, c.1592G>A, c.1177+1G>A, c.1813C>T, c.1801G>A
Cockayne Syndrome Type A
Condition Gene/Varient
Cockayne Syndrome Type A Gene:ERCC8. Exons: NM_000082.3:1-12. Variants(3): c.37G>T, c.966C>A, c.479C>T
Cockayne Syndrome Type B
Condition Gene/Varient
Cockayne Syndrome Type B Gene:ERCC6. Exons: NM_000124.2:2-21. Variants(4): c.1550G>A, c.3592_3593insGA, c.2203C>T, c.1357C>T
Cohen syndrome
Condition Gene/Varient
Cohen syndrome Gene:VPS13B. Exons: NM_017890.4:2-62. Variants(1): c.3348_3349delCT
COL17A1-Related Junctional Epidermolysis Bullosa
Condition Gene/Varient
COL17A1-Related Junctional Epidermolysis Bullosa Gene:COL17A1. Exons: NM_000494.3:2-56. Variants(15): c.1706delC, c.3676C>T, c.433C>T, c.1898G>A, c.2336-2A>G, c.2944_2947+1delGAAGG, c.2383C>T, c.520_521delAG, c.2564T>G, c.2965delA, c.3908G>A, c.4003_4004delGG, c.4150_4151insG, c.2336-1G>T, c.3067C>T
COL4A3-Related Autosomal Recessive Alport Syndrome
Condition Gene/Varient
COL4A3-Related Autosomal Recessive Alport Syndrome Gene:COL4A3. Exons: NM_000091.4:2-52. Variants(3): c.4441C>T, c.4420_4424delCTTTT, c.4571C>G
COL4A4-Related Autosomal Recessive Alport Syndrome
Condition Gene/Varient
COL4A4-Related Autosomal Recessive Alport Syndrome Gene:COL4A4. Exons: NM_000092.4:2-48. Variants(5): c.3601G>A, c.4129C>T, c.3713C>A, c.4923C>A, c.4715C>T
Combined Oxidative Phosphorylation Deficiency 1
Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 1 Gene:GFM1. Exons: NM_024996.5:1-18. Variants(3): c.1487T>G, c.748C>T, c.139C>T
Combined Oxidative Phosphorylation Deficiency 2
Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 2 Gene:MRPS16. Exons: NM_016065.3:1-3. Variants(1): c.331C>T
Combined Oxidative Phosphorylation Deficiency 3
Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 3 Gene:TSFM. Exons: NM_001172696.1:1-4,6-7. Variants(1): c.997C>T
Combined Oxidative Phosphorylation Deficiency 5
Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 5 Gene:MRPS22. Exons: NM_020191.2:1-8. Variants(2): c.509G>A, c.644T>C
Combined pituitary hormone deficiency 1
Condition Gene/Varient
Combined pituitary hormone deficiency 1 Gene:POU1F1. Exons: NM_000306.2:1-6. Variants(10): c.472G>C, c.433A>T, c.515G>A, c.748G>T, c.514C>T, c.688G>A, c.577T>C, c.404T>G, c.428G>A, c.715C>T
Combined pituitary hormone deficiency 3
Condition Gene/Varient
Combined pituitary hormone deficiency 3 Gene:LHX3. Exons: NM_014564.3:2-3,5-6. Variants(3): c.347A>G, c.687G>A, c.644C>T
Combined pituitary hormone deficiency 2
Condition Gene/Varient
Combined pituitary hormone deficiency 2 Gene:PROP1. Exons: NM_006261.4:1-3. Variants(17): c.349T>A, c.150delA, c.263T>C, c.310delC, c.358C>T, c.343-11C>G, c.157delA, c.247C>T, c.218G>A, c.301_302delAG, c.469_470insT, c.109+1G>T, c.112_124delTCGAGTGCTCCAC, c.2T>C, c.373C>T, c.295C>T, c.217C>T
Combined SAP Deficiency
Condition Gene/Varient
Combined SAP Deficiency Gene:PSAP. Exons: NM_002778.2:1-14. Variants(1): c.1A
T Cone Dystrophy 4
Condition Gene/Varient
T Cone Dystrophy 4 Gene:PDE6C. Exons: NM_006204.3:1-22. Variants(12): c.85C>T, c.2457T>A, c.633G>C, c.256_257insAG, c.1483- 2A>G, c.826C>T, c.2368G>A, c.481-12T>A, c.967T>A, c.1805A>T, c.1682dupA, c.1363A>G
Cone-rod Dystrophy 3
Condition Gene/Varient
Cone-rod Dystrophy 3 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(6): c.2616_2617delCT, c.5714+5G>A, c.5285C>A, c.3540_3555delGTCTAAGGGTTTCTCC, c.2888delG, c.5461-10T>C
Congenital Amegakaryocytic Thrombocytopenia
Condition Gene/Varient
Congenital Amegakaryocytic Thrombocytopenia Gene:MPL. Exons: NM_005373.2:1-12. Variants(5): c.823C>A, c.1473G>A, c.769C>T, c.305G>C, c.556C>T
Congenital Bile Acid Synthesis Defect 4
Condition Gene/Varient
Congenital Bile Acid Synthesis Defect 4 Gene:AMACR. Exons: NM_014324.5:1-5. Variants(1): c.320T>C
Congenital Bile Acid Synthesis Defect 3
Condition Gene/Varient
Congenital Bile Acid Synthesis Defect 3 Gene:CYP7B1. Exons: NM_004820.3:2-6. Variants(1): c.1162C>T T
Congenital Diarrhea 4, Malabsorptive
Condition Gene/Varient
Congenital Diarrhea 4, Malabsorptive Gene:NEUROG3. Exons: NM_020999.3:2. Variants(2): c.278G>T, c.319C>A
Congenital Disorders of Glycosylation Ia
Condition Gene/Varient
Congenital Disorders of Glycosylation Ia Gene:PMM2. Exons: NM_000303.2:1-8. Variants(21): c.422G>A, c.669C>G, c.563A>G, c.338C>T, c.722G>C, c.691G>A, c.647A>T, c.95T>G, c.620T>C, c.484C>T, c.193G>T, c.677C>G, c.349G>C, c.131T>C, c.26G>A, c.385G>A, c.710C>G, c.357C>A, c.395T>C, c.368G>A, c.317A>T
Congenital Disorders of Glycosylation Ib
Condition Gene/Varient
Congenital Disorders of Glycosylation Ib Gene:MPI. Exons: NM_002435.1:1-8. Variants(4): c.656G>A, c.305C>T, c.413T>C, c.884G>A
Congenital Disorders of Glycosylation Ic
Condition Gene/Varient
Congenital Disorders of Glycosylation Ic Gene:ALG6. Exons: NM_013339.3:2-15. Variants(3): c.897_899delAAT, c.1432T>C, c.998C>T
Congenital Disorders of Glycosylation Ie
Condition Gene/Varient
Congenital Disorders of Glycosylation Ie Gene:DPM1. Exons: NM_003859.1:1-9. Variants(2): c.628delC, c.274C>G
Congenital Disorders of Glycosylation IIa
Condition Gene/Varient
Congenital Disorders of Glycosylation IIa Gene:MGAT2. Exons: NM_002408.3:1. Variants(3): c.869C>T, c.785A>G, c.1017T>A
Congenital Disorders of Glycosylation IIc
Condition Gene/Varient
Congenital Disorders of Glycosylation IIc Gene:SLC35C1. Exons: NM_018389.4:1-2. Variants(2): c.923C>G, c.439C>T
Congenital Disorders of Glycosylation IId
Condition Gene/Varient
Congenital Disorders of Glycosylation IId Gene:B4GALT1. Exons: NM_001497.3:1-6. Variants(1): c.1031dupC
Congenital Disorders of Glycosylation IIf
Condition Gene/Varient
Congenital Disorders of Glycosylation IIf Gene:SLC35A1. Exons: NM_006416.4:2-8. Variants(1): c.277_280delGTGCinsTG
Congenital Disorders of Glycosylation Ij
Condition Gene/Varient
Congenital Disorders of Glycosylation Ij Gene:DPAGT1. Exons: NM_001382.3:1-9. Variants(1): c.509A>G
Congenital Disorders of Glycosylation Ik
Condition Gene/Varient
Congenital Disorders of Glycosylation Ik Gene:ALG1. Exons: NM_019109.4:1-9,11,13. Variants(2): c.450C>G, c.434G>A
Congenital Disorders of Glycosylation It
Condition Gene/Varient
Congenital Disorders of Glycosylation It Gene:PGM1. Exons: NM_002633.2:1-11. Variants(2): c.361G>C, c.1507C>T
Congenital Erythropoietic Porphyria
Condition Gene/Varient
Congenital Erythropoietic Porphyria Gene:UROS. Exons: NM_000375.2:2-10. Variants(1): c.217T>C
Congenital Generalized Lipodystrophy Type 2
Condition Gene/Varient
Congenital Generalized Lipodystrophy Type 2 Gene:BSCL2. Exons: NM_032667.6:2-11. Variants(5): c.412C>T, c.823C>T, c.671+5G>A, c.672-3C>G, c.634G>C
Congenital Hypomyelinating Neuropathy 1
Condition Gene/Varient
Congenital Hypomyelinating Neuropathy 1 Gene:EGR2. Exons: NM_000399.3:1-2. Variants(1): c.803T>A
Congenital Hypothryoidism Nongoitrous 1
Condition Gene/Varient
Congenital Hypothryoidism Nongoitrous 1 Gene:TSHR. Exons: NM_000369.2:1-10. Variants(13): c.970C>T, c.1657G>A, c.1798T>C, c.122G>C, c.500T>A, c.1228G>A, c.928C>T, c.326G>A, c.484C>G, c.1637G>A, c.1170T>G, c.1575C>A, c.202C>T
Congenital Hypothryoidism Nongoitrous 4
Condition Gene/Varient
Congenital Hypothryoidism Nongoitrous 4 Gene:TSHB. Exons: NM_000549.3:2-3. Variants(3): c.205C>T, c.145G>A, c.94G>T
Congenital myasthenic Syndrome with tubular aggregates 2
Condition Gene/Varient
Congenital myasthenic Syndrome with tubular aggregates 2 Gene:DPAGT1. Exons: NM_001382.3:1-9. Variants(3): c.349G>A, c.358C>A, c.791T>G
Congenital Plasminogen Deficiency
Condition Gene/Varient
Congenital Plasminogen Deficiency Gene:PLG. Exons: NM_000301.3:1-18. Variants(6): c.112A>G, c.1848G>A, c.1120G>T, c.704G>A, c.693_695delGAA, c.1435G>T
Corneal Endothelial Dystrophy
Condition Gene/Varient
Corneal Endothelial Dystrophy Gene:SLC4A11. Exons: NM_032034.3:1-19. Variants(14): c.1813C>T, c.2240_2240+1insTATGACAC, c.637T>C, c.473_480delGCTTCGCC, c.2233_2240dupTATGACAC, c.2605C>T, c.2528T>C, c.1463G>A, c.1466C>T, c.1391G>A, c.2264G>A, c.353_356delAGAA, c.2606G>A, c.2566A>G
Crigler-Najjar Syndrome
Condition Gene/Varient
Crigler-Najjar Syndrome Gene:UGT1A1. Exons: NM_000463.2:1-5. Variants(5): c.674T>G, c.1021C>T, c.524T>A, c.44T>G, c.991C>T
Crisponi Syndrome
Condition Gene/Varient
Crisponi Syndrome Gene:CRLF1. Exons: NM_004750.4:2-6,8-9. Variants(12): c.538C>T, c.829C>T, c.413C>T, c.303delC, c.527+5G>A, c.713_714insC, c.852G>T, c.708_709delCCinsT, c.935G>A, c.845_846delTG, c.226T>G, c.676dupA
Cystic Fibrosis
Condition Gene/Varient
Crisponi Syndrome Gene:CFTR. Exons: NM_000492.3:1-27. Variants(151): c.1397C>A, c.3752G>A, c.579+1G>T, c.3937C>T, c.2583delT, c.1397C>G, c.1911delG, c.1209+1G>A, c.948delT, c.1130_1131insA, c.2834C>T, c.1007T>A, c.2668C>T, c.273+1G>A, c.3276C>G, c.3744delA, c.2464G>T, c.223C>T, c.3154T>G, c.328G>C, c.1680-1G>A, c.1766+1G>A, c.1A>G, c.3846G>A, c.3528delC, c.366T>A, c.2988G>A, c.2657+5G>A, c.803delA, c.200C>T, c.1865G>A, c.3310G>T, c.178G>T, c.2175_2176insA, c.3454G>C, c.1327_1330dupGATA, c.1766+3A>G, c.262_263delTT, c.164+12T>C, c.2551C>T, c.1022_1023insTC, c.3302T>A, c.2052delA, c.3276C>A, c.2780T>C, c.3873+1G>A, c.3230T>C, c.273+3A>C, c.3536_3539delCCAA, c.1585-8G>A, c.2538G>A, c.325_327delTATinsG, c.4077_4080delTGTTinsAA, c.489+1G>T, c.3197G>A, c.3587C>G, c.3140-26A>G, c.3717+4A>G, c.1393-1G>A, c.274G>A, c.1466C>A, c.1075C>A, c.613C>T, c.1572C>A, c.349C>T, c.2249C>T, c.115C>T, c.1055G>A, c.3659delC, c.3764C>A, c.292C>T, c.1675G>A, c.2537G>A, c.254G>A, c.1203G>A, c.350G>A, c.1079C>A, c.2128A>T, c.1202G>A, c.1766+1G>T, c.3612G>A, c.1679G>A, c.658C>T, c.4251delA, c.2491G>T, c.2052_2053insA, c.2988+1G>A, c.1645A>C, c.1081delT, c.3712C>T, c.3484C>T, c.1624G>T, c.1923_1931delCTCAAAACTinsA, c.595C>T, c.442delA, c.579+3A>G, c.1519_1521delATC, c.2125C>T, c.1654C>T, c.3196C>T, c.2051_2052delAAinsG, c.2490+1G>A, c.2453delT, c.617T>G, c.3909C>G, c.805_806delAT, c.1013C>T, c.3611G>A, c.3266G>A, c.1679G>C, c.2195T>G, c.580-1G>T, c.1585-1G>A, c.1477C>T, c.772A>G, c.1545_1546delTA, c.1475C>T, c.1766+5G>T, c.1647T>G, c.3773_3774insT, c.1558G>T, c.1156_1157insTA, c.2215delG, c.1364C>A, c.2875delG, c.2012delT, c.274-1G>A, c.1116+1G>A, c.1646G>A, c.988G>T, c.531delT, c.2989-1G>A, c.2290C>T, c.1438G>T, c.1040G>A, c.1721C>A, c.274G>T, c.1657C>T, c.1040G>C, c.722_743delGGAGAATGATGATGAAGTACAG, c.1652G>A, c.2039delC, c.3731G>A, c.3194T>C, c.1521_1523delCTT, c.2869_2870insG, c.3889_3890insT, c.579+5G>A, c.3472C>T, c.1753G>T, c.1000C>T
D-Hydroxyglutaric Aciduria
Condition Gene/Varient
D-Hydroxyglutaric Aciduria Gene:D2HGDH. Exons: NM_152783.3:2-10. Variants(3): c.491-2A>G, c.440T>G, c.1315A>G
D-Bifunctional Protein Deficiency
Condition Gene/Varient
D-Bifunctional Protein Deficiency Gene:HSD17B4. Exons: NM_000414.3:1-24. Variants(5): c.46G>A, c.423_424delGA, c.650A>G, c.1369A>T, c.317G>C
DCLRE1C-Related Omenn Syndrome
Condition Gene/Varient
DCLRE1C-Related Omenn Syndrome Gene:DCLRE1C. Exons: NM_001033855.1:1-7,9-14. Variants(1): c.2T>C
Dejerine-Sottas disease, autosomal recessive
Condition Gene/Varient
Dejerine-Sottas disease, autosomal recessive Gene:PRX. Exons: NM_181882.2:4-7. Variants(3): c.247delC, c.2857C>T, c.1102C>T
Dent Disease
Condition Gene/Varient
Dent Disease Gene:OCRL. Exons: NM_000276.3:2-24. Variants(2): c.166_167delAT, c.2530C>T
Diastrophic Dysplasia
Condition Gene/Varient
Diastrophic Dysplasia Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1724delA, c.-26+2T>C, c.1361A>C, c.1957T>A
Dihydropyrimidine Dehydrogenase Deficiency
Condition Gene/Varient
Dihydropyrimidine Dehydrogenase Deficiency Gene:DPYD. Exons: NM_000110.3:1-23. Variants(1): c.1905+1G>A
Donnai-Barrow Syndrome
Condition Gene/Varient
Donnai-Barrow Syndrome Gene:LRP2. Exons: NM_004525.2:2-79. Variants(13): c.8519_8522delATTT, c.770-2A>G, c.1341+2T>G, c.9484_9485delGT, c.6160G>A, c.2640-1G>A, c.8452+1G>A, c.13139_13140insC, c.11469_11472delTTTG, c.10195C>T, c.7564T>C, c.9358_9359delAG, c.1093C>T
Donohue Syndrome
Condition Gene/Varient
Donohue Syndrome Gene:INSR. Exons: NM_000208.2:2-22. Variants(4): c.1114C>T, c.1378A>G, c.698T>C, c.172G>A
Duchenne Muscular Dystrophy
Condition Gene/Varient
Duchenne Muscular Dystrophy Gene:DMD. Exons: NM_004006.2:1-79. Variants(903): c.6223C>T, c.10018T>C, c.1332-9A>G, c.3121C>T, c.4558G>T, c.4711A>T, c.10019G>A, c.10033C>T, c.7339C>T, c.187-1G>C, c.8754delG, c.440C>A, c.8391-1G>C, c.3679C>T, c.5985T>G, c.1132C>T, c.2974C>T, c.7542+1G>A, c.7672C>T, c.3464_3471delGTTTGGAG, c.9663delA, c.9739C>T, c.3151C>T, c.903C>A, c.4841delG, c.10202T>G, c.8713C>T, c.2368C>T, c.7392delC, c.10606delC, c.1594C>T, c.9691C>T, c.2365G>T, c.5314A>T, c.6913-2A>G, c.5287C>T, c.3562A>T, c.357+1G>C, c.1633A>T, c.2776C>T, c.5401_5402delAT, c.409G>T, c.8686A>T, c.9649+2T>C, c.9001C>T, c.721C>T, c.1483-1G>C, c.1603-1G>A, c.748G>T, c.10554-2A>G, c.3259C>T, c.4898_4899delAG, c.7739delA, c.7873delC, c.3274A>T, c.10855C>T, c.9176delG, c.1978_1979delAA, c.1952G>A, c.10563delA, c.3365_3366delAG, c.2803+1G>A, c.1865C>G, c.9807+4delA, c.4057G>T, c.9974+2T>A, c.4084C>T, c.10141C>T, c.5563C>T, c.10094C>A, c.2866C>T, c.8938-9T>A, c.3427C>T, c.2991C>G, c.2638delC, c.1093C>T, c.745C>T, c.7542+2T>C, c.10135A>T, c.2475G>A, c.4087A>T, c.9600_9601delAA, c.3603+2T>G, c.4757G>A, c.9974+1G>T, c.488G>A, c.8176G>T, c.8774G>A, c.5800G>T, c.7247delT, c.6730C>T, c.313A>T, c.1324C>T, c.5209C>T, c.2128A>T, c.5266C>T, c.1527_1530delTCTC, c.2299G>T, c.9100C>T, c.3244G>T, c.4519-1G>C, c.8357G>A, c.9135delT, c.1873C>T, c.2407C>T, c.1663C>T, c.2281_2285delGAAAA, c.3430C>T, c.10088delC, c.4375C>T, c.2512C>T, c.4071+1G>A, c.1207G>T, c.2761delG, c.7229G>A, c.3125delA, c.6238C>T, c.2314G>T, c.7564C>T, c.2302C>T, c.8914C>T, c.6436A>T, c.689delT, c.9862G>T, c.6614+2T>C, c.6674T>G, c.5694_5697delAAAA, c.10477delC, c.4693C>T, c.3432+1G>T, c.10121delA, c.1615C>T, c.5845delC, c.5771_5772delAG, c.1555G>T, c.9649+5G>T, c.10219G>T, c.2956C>T, c.1235delT, c.6460C>T, c.9090delC, c.7054G>T, c.5637G>A, c.10651C>T, c.3470delA, c.1331+1G>T, c.7720C>T, c.4870C>T, c.2650C>T, c.1974delT, c.6200delC, c.2949+1G>T, c.7310- 1G>A, c.676_678delAAG, c.9148C>T, c.6804_6807delACAA, c.3478_3479delGT, c.1474C>T, c.10969G>T, c.9380C>G, c.3196G>T, c.453T>A, c.9183G>A, c.5032C>T, c.4980delG, c.7755G>A, c.580C>T, c.6276C>G, c.3397G>T, c.4545_4549delGAAGT, c.6277A>T, c.568C>T, c.8608C>T, c.6592C>T, c.10086+5G>C, c.53delA, c.31+1G>T, c.7657C>T, c.9337C>T, c.2558T>A, c.883C>T, c.1061G>A, c.6790C>T, c.1087C>T, c.8944C>T, c.9563+1215A>G, c.583C>T, c.4151delA, c.4103delG, c.4852C>T, c.8807_8808delTC, c.6255G>A, c.2707G>T, c.4150G>T, c.433C>T, c.3033delC, c.5272_5273delTC, c.1682G>A, c.1388G>A, c.5653C>T, c.10279C>T, c.2236G>T, c.10498_10499delAG, c.2968C>T, c.10003G>C, c.9403C>T, c.8416C>T, c.4294C>T, c.10108C>T, c.1292G>A, c.516delC, c.1726delT, c.3940C>T, c.6614+1G>A, c.2869C>T, c.6393_6394delAA, c.5917C>T, c.3768delG, c.5766_5770delGAAAG, c.6373C>T, c.956C>G, c.8443C>T, c.1783G>T, c.7309+1G>A, c.1489C>T, c.4996C>T, c.5740-2A>G, c.503C>A, c.7582G>T, c.6439-1G>A, c.2804-2A>C, c.178C>T, c.4845+2T>C, c.7768_7771delGAAG, c.475_476delTT, c.3220G>T, c.10072G>T, c.6423C>A, c.9197C>A, c.3086G>A, c.4918delA, c.5530C>T, c.10203delA, c.3268C>T, c.5350G>T, c.9361+5G>C, c.10223+1G>C, c.6880A>T, c.8087delT, c.8214G>A, c.2227C>T, c.4147C>T, c.11G>A, c.7348delG, c.1990C>T, c.2737delG, c.4071+2T>A, c.9360C>A, c.433delC, c.998C>A, c.5461G>T, c.9072G>A, c.6292C>T, c.4414C>T, c.2791G>T, c.673A>T, c.9364delG, c.9461T>A, c.3147delA, c.3336delG, c.724C>T, c.3603+1G>T, c.9928C>T, c.6943G>T, c.8269G>T, c.9619_9626delTGTAAAGC, c.7401_7402delGGinsAT, c.1812delC, c.4108C>T, c.253C>T, c.2293- 1G>T, c.9427C>T, c.6364G>T, c.58delA, c.572C>G, c.5154+2T>G, c.9986delT, c.965T>A, c.8074C>T, c.9959delC, c.10368delT, c.7105G>T, c.193G>T, c.10225_10229delCCCGT, c.9333delA, c.1619G>A, c.1149+2T>C, c.10722delC, c.8038C>T, c.2359delC, c.777delA, c.6955C>T, c.565C>T, c.10903C>T, c.9938G>T, c.9204_9207delCAAA, c.2701G>T, c.1683G>A, c.4518+5G>A, c.9649+1G>A, c.3469G>T, c.94-1G>A, c.772_773delCC, c.1533_1536delTCAC, c.8098A>T, c.1609G>T, c.8027+1G>A, c.7669delA, c.9563+1G>A, c.10171C>T, c.9109C>T, c.10126delC, c.2669T>G, c.530+1G>T, c.6391C>T, c.8728G>T, c.2276T>G, c.3188G>A, c.3337C>T, c.2622+1G>A, c.6720delT, c.6283C>T, c.2873C>G, c.3864delA, c.8287delC, c.2933_2934delGA, c.6544C>T, c.8064_8065delTA, c.9346C>T, c.832-15A>G, c.2017C>T, c.9748G>T, c.272T>A, c.5044G>T, c.5851C>T, c.6429G>A, c.5899C>T, c.1519delG, c.372delG, c.3222delA, c.9445C>T, c.354G>A, c.2665C>T, c.907C>T, c.5487_5488delAA, c.9568C>T, c.9471_9474delTTAT, c.8420G>A, c.1699G>T, c.2270C>G, c.2521C>T, c.3061G>T, c.4117C>T, c.5154+1G>A, c.5542A>T, c.2381-2A>G, c.4213C>T, c.1438G>T, c.3432+2240A>G, c.615T>A, c.5551C>T, c.649+2T>C, c.3347_3350delAGAA, c.5922+2T>C, c.5641C>T, c.2767delT, c.133C>T, c.8009G>A, c.6868A>T, c.9225-1G>A, c.4729C>T, c.3580C>T, c.10086+1G>T, c.199G>T, c.5554C>T, Exon 1-79 del, Exon 10- 11 del, Exon 10-13 del, Exon 10-17 del, Exon 10-18 del, Exon 10-23 del, Exon 10-30 del, Exon 10-33 del, Exon 10-42 del, Exon 10-43 del, Exon 10-44 del, Exon 10-46 del, Exon 10-48 del, Exon 10-53 del, Exon 10-62 del, Exon 11-13 del, Exon 11-41 del, Exon 11-48 del, Exon 1- 18 del, Exon 1-2 del, Exon 1-20 del, Exon 12-13 del, Exon 12-16 del, Exon 12-17 del, Exon 12-18 del, Exon 12-19 del, Exon 1-22 del, Exon 12-20 del, Exon 12-25 del, Exon 12-30 del, Exon 12-41 del, Exon 12-43 del, Exon 12-45 del, Exon 12-50 del, Exon 1-30 del, Exon 13-18 del, Exon 13-19 del, Exon 13-29 del, Exon 13-41 del, Exon 13-43 del, Exon 13-44 del, Exon 13-48 del, Exon 14-17 del, Exon 14-18 del, Exon 14- 43 del, Exon 14-60 del, Exon 1-5 del, Exon 1-6 del, Exon 16-17 del, Exon 16-19 del, Exon 16-27 del, Exon 16-44 del, Exon 1-7 del, Exon 17- 19 del, Exon 17-21 del, Exon 1-73 del, Exon 17-44 del, Exon 17-48 del, Exon 17-51 del, Exon 1-79 del, Exon 18-20 del, Exon 18-22 del, Exon 18-26 del, Exon 18-29 del, Exon 18-32 del, Exon 18-37 del, Exon 18-38 del, Exon 18-39 del, Exon 18-41 del, Exon 18-44 del, Exon 19- 20 del, Exon 19-21 del, Exon 19-44 del, Exon 20-21 del, Exon 20-22 del, Exon 20-23 del, Exon 20-26 del, Exon 20-29 del, Exon 20-37 del, Exon 20-41 del, Exon 20-43 del, Exon 20-45 del, Exon 20-47 del, Exon 20-50 del, Exon 2-12 del, Exon 2-13 del, Exon 21-42 del, Exon 21-43 del, Exon 2-17 del, Exon 2-18 del, Exon 2-19 del, Exon 2-20 del, Exon 22-25 del, Exon 22-30 del, Exon 22-31 del, Exon 22-33 del, Exon 22-37 del, Exon 22-41 del, Exon 22-47 del, Exon 2-29 del, Exon 2-30 del, Exon 24-26 del, Exon 24-27 del, Exon 2-44 del, Exon 2-6 del, Exon 26-43 del, Exon 26-44 del, Exon 2-7 del, Exon 28-49 del, Exon 30-42 del, Exon 3-11 del, Exon 3-12 del, Exon 3-13 del, Exon 31-40 del, Exon 31-43 del, Exon 3-15 del, Exon 31-57 del, Exon 3-16 del, Exon 3-17 del, Exon 3-19 del, Exon 3-20 del, Exon 3-21 del, Exon 3-24 del, Exon 3-25 del, Exon 3-26 del, Exon 3-27 del, Exon 3-28 del, Exon 3-29 del, Exon 3-30 del, Exon 3-34 del, Exon 33-43 del, Exon 33-45 del, Exon 3-37 del, Exon 3-4 del, Exon 3-41 del, Exon 3-42 del, Exon 3-43 del, Exon 3-44 del, Exon 35-42 del, Exon 35-43 del, Exon 35-44 del, Exon 35-45 del, Exon 3-6 del, Exon 3-7 del, Exon 37-43 del, Exon 3-8 del, Exon 38-43 del, Exon 39-43 del, Exon 4-12 del, Exon 4-13 del, Exon 4-17 del, Exon 4-18 del, Exon 4-19 del, Exon 4-22 del, Exon 42-43 del, Exon 42-45 del, Exon 42-50 del, Exon 42-53 del, Exon 4-30 del, Exon 43-50 del, Exon 43-51 del, Exon 43-52 del, Exon 44-45 del, Exon 44-47 del, Exon 44-49 del, Exon 44-51 del, Exon 44-52 del, Exon 44-53 del, Exon 44-55 del, Exon 44-60 del, Exon 45-46 del, Exon 45-47 del, Exon 45-48 del, Exon 45-49 del, Exon 45-50 del, Exon 45- 51 del, Exon 45-52 del, Exon 45-53 del, Exon 45-54 del, Exon 45-55 del, Exon 45-57 del, Exon 45-58 del, Exon 45-59 del, Exon 45-60 del, Exon 45-62 del, Exon 45-79 del, Exon 4-6 del, Exon 46-47 del, Exon 46-48 del, Exon 46-49 del, Exon 46-50 del, Exon 46-51 del, Exon 46-52 del, Exon 46-53 del, Exon 46-54 del, Exon 46-55 del, Exon 46-60 del, Exon 4-7 del, Exon 47-48 del, Exon 47-49 del, Exon 47-50 del, Exon 47-51 del, Exon 47-52 del, Exon 47-53 del, Exon 47-55 del, Exon 48-49 del, Exon 48-50 del, Exon 48-51 del, Exon 48-52 del, Exon 48-53 del, Exon 48-54 del, Exon 4-9 del, Exon 49-50 del, Exon 49-51 del, Exon 49-52 del, Exon 49-53 del, Exon 49-54 del, Exon 49-57 del, Exon 50-51 del, Exon 50-52 del, Exon 50-53 del, Exon 50-54 del, Exon 50-56 del, Exon 50-59 del, Exon 5-13 del, Exon 51-52 del, Exon 51-53 del, Exon 51-54 del, Exon 51-55 del, Exon 51-60 del, Exon 5-18 del, Exon 52-53 del, Exon 52-55 del, Exon 52-59 del, Exon 52-60 del, Exon 52- 61 del, Exon 52-62 del, Exon 5-29 del, Exon 53-54 del, Exon 53-55 del, Exon 53-56 del, Exon 53-59 del, Exon 53-60 del, Exon 5-37 del, Exon 5-41 del, Exon 5-42 del, Exon 5-50 del, Exon 5-55 del, Exon 55-59 del, Exon 55-61 del, Exon 55-63 del, Exon 55-77 del, Exon 56-61 del, Exon 56-62 del, Exon 56-76 del, Exon 56-79 del, Exon 58-59 del, Exon 5-9 del, Exon 60-63 del, Exon 6-13 del, Exon 6-16 del, Exon 61- 62 del, Exon 61-63 del, Exon 61-64 del, Exon 61-67 del, Exon 6-17 del, Exon 61-79 del, Exon 6-19 del, Exon 6-27 del, Exon 63-79 del, Exon 64-67 del, Exon 64-79 del, Exon 65-67 del, Exon 65-76 del, Exon 6-7 del, Exon 67-69 del, Exon 67-71 del, Exon 6-8 del, Exon 68-73 del, Exon 71-74 del, Exon 72-79 del, Exon 7-28 del, Exon 7-29 del, Exon 73-76 del, Exon 75-76 del, Exon 75-79 del, Exon 7-8 del, Exon 8-11 del, Exon 8-12 del, Exon 8-13 del, Exon 8-15 del, Exon 8-16 del, Exon 8-18 del, Exon 8-19 del, Exon 8-20 del, Exon 8-21 del, Exon 8-22 del, Exon 8-28 del, Exon 8-29 del, Exon 8-30 del, Exon 8-31 del, Exon 8-32 del, Exon 8-34 del, Exon 8-39 del, Exon 8-41 del, Exon 8-44 del, Exon 8-45 del, Exon 8-47 del, Exon 8-55 del, Exon 8-9 del, Exon 9-12 del, Exon 9-34 del, Exon 10-11 dup, Exon 10-16 dup, Exon 10-17 dup, Exon 10-18 dup, Exon 10-19 dup, Exon 10-44 dup, Exon 1-11 dup, Exon 11-40 dup, Exon 12-13 dup, Exon 12-15 dup, Exon 12-19 dup, Exon 12-20 dup, Exon 12-26 dup, Exon 12-30 dup, Exon 12-41 dup, Exon 12-44 dup, Exon 13-17 dup, Exon 13-19 dup, Exon 13-20 dup, Exon 13-29 dup, Exon 13-40 dup, Exon 13-42 dup, Exon 13-44 dup, Exon 1-40 dup, Exon 14-17 dup, Exon 14-18 dup, Exon 14-21 dup, Exon 14-32 dup, Exon 14-34 dup, Exon 14-42 dup, Exon 1-6 dup, Exon 16-17 dup, Exon 16-34 dup, Exon 16-41 dup, Exon 16-42 dup, Exon 17-18 dup, Exon 17-19 dup, Exon 17-41 dup, Exon 1-8 dup, Exon 18-23 dup, Exon 18-27 dup, Exon 18-29 dup, Exon 18-32 dup, Exon 18-33 dup, Exon 18-37 dup, Exon 18-38 dup, Exon 19-41 dup, Exon 19-43 dup, Exon 19-44 dup, Exon 19-45 dup, Exon 19-52 dup, Exon 20-21 dup, Exon 20-27 dup, Exon 20-29 dup, Exon 20-41 dup, Exon 20-43 dup, Exon 20-44 dup, Exon 2-10 dup, Exon 2-11 dup, Exon 21-29 dup, Exon 2-15 dup, Exon 22-25 dup, Exon 22-29 dup, Exon 22-41 dup, Exon 2-26 dup, Exon 2-29 dup, Exon 2-3 dup, Exon 2-33 dup, Exon 2-34 dup, Exon 2-4 dup, Exon 2-5 dup, Exon 2-6 dup, Exon 2-7 dup, Exon 27-30 dup, Exon 2-9 dup, Exon 29-43 dup, Exon 30-35 dup, Exon 30- 42 dup, Exon 30-43 dup, Exon 3-10 dup, Exon 3-11 dup, Exon 3-12 dup, Exon 3-13 dup, Exon 31-32 dup, Exon 31-45 dup, Exon 3-15 dup, Exon 3-16 dup, Exon 3-18 dup, Exon 3-19 dup, Exon 3-20 dup, Exon 3-25 dup, Exon 3-30 dup, Exon 33-34 dup, Exon 3-34 dup, Exon 33-44 dup, Exon 33-60 dup, Exon 3-38 dup, Exon 3-4 dup, Exon 3-41 dup, Exon 3-43 dup, Exon 3-44 dup, Exon 34-41 dup, Exon 3-5 dup, Exon 35-44 dup, Exon 3-6 dup, Exon 36-44 dup, Exon 3-7 dup, Exon 37-43 dup, Exon 3-8 dup, Exon 38-42 dup, Exon 38-44 dup, Exon 38-45 dup, Exon 3-9 dup, Exon 41-44 dup, Exon 4-17 dup, Exon 4-19 dup, Exon 42-43 dup, Exon 42-47 dup, Exon 43-44 dup, Exon 44-47 dup, Exon 44-49 dup, Exon 44-50 dup, Exon 44-52 dup, Exon 44-55 dup, Exon 44-57 dup, Exon 45-47 dup, Exon 45-49 dup, Exon 45-50 dup, Exon 45- 51 dup, Exon 45-52 dup, Exon 45-55 dup, Exon 45-56 dup, Exon 45-59 dup, Exon 45-61 dup, Exon 45-65 dup, Exon 46-47 dup, Exon 46-48 dup, Exon 46-49 dup, Exon 46-51 dup, Exon 46-52 dup, Exon 46-60 dup, Exon 47-49 dup, Exon 47-54 dup, Exon 48-49 dup, Exon 48-50 dup, Exon 48-52 dup, Exon 49-50 dup, Exon 49-51 dup, Exon 49-55 dup, Exon 49-60 dup, Exon 50-52 dup, Exon 50-54 dup, Exon 50-55 dup, Exon 50-59 dup, Exon 50-62 dup, Exon 5-11 dup, Exon 51-55 dup, Exon 51-57 dup, Exon 52-55 dup, Exon 52-60 dup, Exon 52-62 dup, Exon 5-27 dup, Exon 5-33 dup, Exon 53-54 dup, Exon 53-55 dup, Exon 53-60 dup, Exon 53-63 dup, Exon 5-41 dup, Exon 5-44 dup, Exon 54-57 dup, Exon 55-60 dup, Exon 55-63 dup, Exon 55-76 dup, Exon 5-6 dup, Exon 56-57 dup, Exon 56-61 dup, Exon 56-62 dup, Exon 56-63 dup, Exon 56-64 dup, Exon 56-66 dup, Exon 56-77 dup, Exon 5-7 dup, Exon 57-60 dup, Exon 58-63 dup, Exon 5-9 dup, Exon 61-62 dup, Exon 61-63 dup, Exon 61-64 dup, Exon 63-79 dup, Exon 64-67 dup, Exon 66-67 dup, Exon 6-67 dup, Exon 6-7 dup, Exon 69-79 dup, Exon 8-10 dup, Exon 8-11 dup, Exon 8-12 dup, Exon 8-13 dup, Exon 8-15 dup, Exon 8-16 dup, Exon 8-29 dup, Exon 8-30 dup, Exon 8-44 dup, Exon 8-9 dup, Exon 9-16 dup, Exon 9-41 dup
Dyskeratosis Congenita, Autosomal Recessive 1
Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 1 Gene:NOP10. Exons: NM_018648.3:1-2. Variants(1): c.100C>T
Dyskeratosis Congenita, Autosomal Recessive 2
Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 2 Gene:NHP2. Exons: NM_017838.3:1-4. Variants(2): c.460T>A, c.415T>C
Dyskeratosis Congenita, Autosomal Recessive 4
Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 4 Gene:TERT. Exons: NM_198253.2:2-7,9-16. Variants(3): c.2110C>T, c.2431C>T, c.2701C>T
Dyskeratosis Congenita, X-linked
Condition Gene/Varient
Dyskeratosis Congenita, X-linked Gene:DKC1. Exons: NM_001363.3:1-15. Variants(7): c.106T>G, c.115A>G, c.91C>G, c.146C>T, c.113T>C, c.214_215delCTinsTA, c.196A>G
Dystonia 16
Condition Gene/Varient
Dystonia 16 Gene:PRKRA. Exons: NM_003690.4:2-8. Variants(2): c.267_268delTA, c.665C>T
Early Infantile Epileptic Encephalopathy 3
Condition Gene/Varient
Early Infantile Epileptic Encephalopathy 3 Gene:SLC25A22. Exons: NM_024698.5:2-10. Variants(2): c.706G>T, c.617C>T
EEM Syndrome(Ectodermal Dysplasia, Ectrodactyly, and Macular Dystrophy)
Condition Gene/Varient
EEM Syndrome(Ectodermal Dysplasia, Ectrodactyly, and Macular Dystrophy) Gene:CDH3. Exons: NM_001793.4:1-16. Variants(3): c.965A>T, c.1508G>A, c.830delG
Ehlers-Danlos Syndrome Type VI
Condition Gene/Varient
Ehlers-Danlos Syndrome Type VI Gene:PLOD1. Exons: NM_000302.3:1-19. Variants(5): c.2032G>A, c.955C>T, c.1533C>G, c.1836G>C, c.2008C>T
Ehlers-Danlos Syndrome Type VIIC
Condition Gene/Varient
Ehlers-Danlos Syndrome Type VIIC Gene:ADAMTS2. Exons: NM_014244.4:2-22. Variants(2): c.2384G>A, c.673C>T
Ehlers-Danlos syndrome, cardiac valvular form
Condition Gene/Varient
Ehlers-Danlos syndrome, cardiac valvular form Gene:COL1A2. Exons: NM_000089.3:1,3-52. Variants(5): c.1404+1G>A, c.1404+1G>C, c.293_294insC, c.3601G>T, c.540+5G>A
Enhanced S-cone Syndrome
Condition Gene/Varient
Enhanced S-cone Syndrome Gene:NR2E3. Exons: NM_014249.2:1-8. Variants(4): c.119-2A>C, c.932G>A, c.226C>T, c.227G>A
Epidermolysis Bullosa Pruriginosa
Condition Gene/Varient
Epidermolysis Bullosa Pruriginosa Gene:COL7A1. Exons: NM_000094.3:1-118. Variants(18): c.2471_2472insG, c.7411C>T, c.4119+1G>T, c.7787delG, c.8479C>T, c.6091G>A, c.4039G>C, c.425A>G, c.427-2A>G, c.3861delG, c.8245G>A, c.5532+1G>A, c.6187C>T, c.933C>A, c.5821-1G>A, c.4888C>T, c.6205C>T, c.5819delC
Epidermolysis Bullosa Simplex with Pyloric Atresia
Condition Gene/Varient
Epidermolysis Bullosa Simplex with Pyloric Atresia Gene:PLEC. Exons: NM_000445.3:2-31,33. Variants(4): c.6955C>T, c.913C>T, c.12043_12044insG, c.9085C>T
Ethylmalonic Encephalopathy
Condition Gene/Varient
Ethylmalonic Encephalopathy Gene:ETHE1. Exons: NM_014297.3:2-7. Variants(5): c.604dupG, c.487C>T, c.221dupA, c.440_450delACAGCATGGCC, c.554T>G
Factor V Deficiency
Condition Gene/Varient
Factor V Deficiency Gene:F5. Exons: NM_000130.4:1-25. Variants(5): c.1160T>C, c.5189A>G, c.2401C>T, c.6304C>T, c.439G>T
Familial Dysautonomia
Condition Gene/Varient
Familial Dysautonomia Gene:IKBKAP. Exons: NM_003640.3:2-37. Variants(3): c.2087G>C, c.2741C>T, c.2204+6T>C
Familial Exudative Vitreoretinopathy 4
Condition Gene/Varient
Familial Exudative Vitreoretinopathy 4 Gene:LRP5. Exons: NM_002335.2:2-23. Variants(5): c.804_813delGGGGAAGAGG, c.2254C>G, c.4099G>A, c.1709G>A, c.1828G>A
Familial Mediterranean Fever
Condition Gene/Varient
Familial Mediterranean Fever Gene:MEFV. Exons: NM_000243.2:1-10. Variants(11): c.2040G>A, c.1437C>G, c.2040G>C, c.1958G>A, c.2082G>A, c.2080A>G, c.2177T>C, c.800C>T, c.2282G>A, c.2230G>T, c.2076_2078delAAT
Fanconi anemia, complementation group A
Condition Gene/Varient
Fanconi anemia, complementation group A Gene:FANCA. Exons: NM_000135.2:2-43. Variants(5): c.2574C>G, c.1115_1118delTTGG, c.233_236delTTGA, c.4130C>G, c.3788_3790delTCT
Fanconi anemia, complementation group C
Condition Gene/Varient
Fanconi anemia, complementation group C Gene:FANCC. Exons: NM_000136.2:2-15. Variants(6): c.1487T>G, c.1642C>T, c.67delG, c.553C>T, c.37C>T, c.456+4A>T
Fanconi anemia, complementation group D1
Condition Gene/Varient
Fanconi anemia, complementation group D1 Gene:BRCA2. Exons: NM_000059.3:2-27. Variants(8): c.8488-1G>A, c.9900dupA, c.4648G>T, c.7691_7692insAT, c.658_659delGT, c.631+1G>A, c.5837_5838delCAinsAG, c.631+2T>G
Fanconi anemia, complementation group E
Condition Gene/Varient
Fanconi anemia, complementation group E Gene:FANCE. Exons: NM_021922.2:2-10. Variants(3): c.1114-8G>A, c.355C>T, c.421C>T
Fanconi anemia, complementation group G
Condition Gene/Varient
Fanconi anemia, complementation group G Gene:FANCG. Exons: NM_004629.1:1-14. Variants(8): c.1066C>T, c.307+1G>C, c.1795_1804delTGGATCCGTC, c.637_643delTACCGCC, c.1480+1G>C, c.1183_1192delGAGGTGTTTT, c.925-2A>G, c.313G>T
Fanconi anemia, complementation group I
Condition Gene/Varient
Fanconi anemia, complementation group I Gene:FANCI. Exons: NM_001113378.1:2-38. Variants(2): c.3853C>T, c.3854G>A
Fanconi anemia, complementation group J
Condition Gene/Varient
Fanconi anemia, complementation group J Gene:BRIP1. Exons: NM_032043.2:2-20. Variants(2): c.1045G>C, c.2392C>T
Fanconi anemia, complementation group L
Condition Gene/Varient
Fanconi anemia, complementation group L Gene:FANCL. Exons: NM_018062.3:1-14. Variants(2): c.1096_1099dupATTA, c.1007_1009delTAT
Fanconi anemia, complementation group M
Condition Gene/Varient
Fanconi anemia, complementation group M Gene:FANCM. Exons: NM_020937.2:1-23. Variants(1): c.2171C>A
Fanconi anemia, complementation group N
Condition Gene/Varient
Fanconi anemia, complementation group N Gene:PALB2. Exons: NM_024675.3:1-13. Variants(4): c.1653T>A, c.3116delA, c.2962C>T, c.3549C>G
Fanconi anemia, complementation group O
Condition Gene/Varient
Fanconi anemia, complementation group O Gene:RAD51C. Exons: NM_058216.1:1-9. Variants(1): c.773G>A
Fanconi anemia, complementation group P
Condition Gene/Varient
Fanconi anemia, complementation group P Gene:SLX4. Exons: NM_032444.2:2-15. Variants(5): c.286delA, c.1093delC, c.514delC, c.1163+3_1163+4insT, c.1163+2T>A
FGA-Related Congenital Afibrinogenemia
Condition Gene/Varient
FGA-Related Congenital Afibrinogenemia Gene:FGA. Exons: NM_021871.2:1-5. Variants(3): c.1359dupC, c.1039C>T, c.510+1G>T
FGB-Related Congenital Afibrinogenemia
Condition Gene/Varient
FGB-Related Congenital Afibrinogenemia Gene:FGB. Exons: NM_005141.4:1-8. Variants(3): c.1148T>G, c.1289G>A, c.794C>T
Fibrochondrogenesis
Condition Gene/Varient
Fibrochondrogenesis Gene:COL11A1. Exons: NM_001854.3:1-67. Variants(2): c.2350G>C, c.1750dupG
Focal Segmental Glomerulosclerosis 3
Condition Gene/Varient
Focal Segmental Glomerulosclerosis 3 Gene:CD2AP. Exons: NM_012120.2:1-18. Variants(2): c.730-1delGinsCT, c.1834C>T
FRAS1-Related Fraser Syndrome
Condition Gene/Varient
FRAS1-Related Fraser Syndrome Gene:FRAS1. Exons: NM_025074.6:1-74. Variants(7): c.8602C>T, c.6991_6992insGG, c.5605_5606insT, c.4271C>G, c.9013C>T, c.7682+1G>T, c.3799C>T
FREM2-Related Fraser Syndrome
Condition Gene/Varient
FREM2-Related Fraser Syndrome Gene:FREM2. Exons: NM_207361.4:1-24. Variants(2): c.5914G>A, c.7519+1G>A
Friedreich Ataxia
Condition Gene/Varient
Friedreich Ataxia Gene:FXN. Exons: NM_000144.4:2-5. Variants(5): c.317T>G, c.517T>G, c.460A>T, c.389G>T, c.385-2A>G
Frontometaphyseal Dysplasia
Condition Gene/Varient
Frontometaphyseal Dysplasia Gene:FLNA. Exons: NM_001456.3:2-47. Variants(2): c.3557C>T, c.3476A>C
Fucosidosis
Condition Gene/Varient
Fucosidosis Gene FUCA1. Exons: NM_000147.4:1-8. Variants(6): c.1229T>G, c.244C>T, c.1160G>A, c.1138G>T, c.1279C>T, c.648C>A:
Fuhrmann Dyndrome
Condition Gene/Varient
Fuhrmann Dyndrome Gene:WNT7A. Exons: NM_004625.3:1-4. Variants(1): c.325G>A
Fumarate Hydratase Deficiency
Condition Gene/Varient
Fumarate Hydratase Deficiency Gene:FH. Exons: NM_000143.3:1-10. Variants(2): c.1127A>C, c.521C>G
Galactosemia
Condition Gene/Varient
Galactosemia Gene:GALT. Exons: NM_000155.3:1-11. Variants(85): c.512T>C, c.563A>G, c.957C>G, c.1048A>G, c.1030C>T, c.337G>A, c.404C>T, c.221T>C, c.997C>G, c.379A>G, c.855G>T, c.938G>A, c.667C>A, c.1138T>C, c.595G>A, c.505C>A, c.610C>T, c.980T>C, c.692G>A, c.920C>A, c.425T>A, c.462G>A, c.677T>C, c.844C>G, c.428C>T, c.989C>T, c.1001A>G, c.160C>T, c.404C>G, c.1014C>G, c.290A>G, c.507+2T>C, c.580T>C, c.424A>G, c.619C>T, c.974C>T, c.238C>T, c.626A>G, c.199C>T, c.611G>C, c.377+1G>A, c.382G>A, c.1098C>A, c.691C>T, c.949delC, c.998G>A, c.948G>A, c.815G>A, c.899G>A, c.253-2A>G, c.776G>A, c.536G>A, c.1140A>C, c.524G>A, c.881T>A, c.452T>C, c.747G>A, c.602G>A, c.775C>T, c.855G>C, c.200G>A, c.82+2T>A, c.329- 2A>C, c.18delC, c.564+1G>A, c.130G>A, c.616C>T, c.821-2A>G, c.634C>T, c.490delC, c.967T>C, c.413C>T, c.824delT, c.1075A>T, c.626A>C, c.687G>T, c.947G>A, c.341A>C, c.25C>T, c.443G>A, c.958G>A, c.607G>A, c.122G>A, c.1030C>A, c.584T>C
Gaucher Disease, Atypical
Condition Gene/Varient
Gaucher Disease, Atypical Gene:PSAP. Exons: NM_002778.2:1-14. Variants(4): c.1288C>T, c.1145G>T, c.1144T>G, c.1046T>C
Gaucher Disease
Condition Gene/Varient
Gaucher Disease Gene:GBA. Exons: NM_001005741.2:.. Variants(4): c.1226A>G, c.115+1G>A, c.84dupG, c.1448T>C
Generalized arterial calcification of infancy 1
Condition Gene/Varient
Generalized arterial calcification of infancy 1 Gene:ENPP1. Exons: NM_006208.2:2-25. Variants(6): c.1112A>T, c.913C>A, c.783C>G, c.1612G>C, c.2677G>T, c.1025G>T
Giant Axonal Neuropathy
Condition Gene/Varient
Giant Axonal Neuropathy Gene:GAN. Exons: NM_022041.3:2-11. Variants(7): c.505G>A, c.1268T>C, c.1456G>A, c.413G>A, c.1447C>T, c.1429C>T, c.601C>T
GLDC-Related Glycine Encephalopathy
Condition Gene/Varient
GLDC-Related Glycine Encephalopathy Gene:GLDC. Exons: NM_000170.2:2-25. Variants(4): c.1705G>A, c.1691G>T, c.2216G>A, c.1166C>T
Glomerulosclerosis, Focal segmental,1
Condition Gene/Varient
Glomerulosclerosis, Focal segmental,1 Gene:ACTN4. Exons: NM_004924.4:2-21. Variants(3): c.776C>T, c.763A>G, c.784T>C
Glutaric Acidemia I
Condition Gene/Varient
Glutaric Acidemia I Gene:GCDH. Exons: NM_000159.2:2-12. Variants(7): c.680G>C, c.1198G>A, c.1204C>T, c.1093G>A, c.1262C>T, c.883T>C, c.877G>A
Glutaric Acidemia IIA
Condition Gene/Varient
Glutaric Acidemia IIA Gene:ETFA. Exons: NM_000126.3:1-12. Variants(3): c.470T>G, c.797C>T, c.346G>
A Glutaric Acidemia IIB
Condition Gene/Varient
A Glutaric Acidemia IIB Gene:ETFB. Exons: NM_001985.2:1-6. Variants(2): c.491G>A, c.382G>A
Glutaric Acidemia IIC
Condition Gene/Varient
Glutaric Acidemia IIC Gene:ETFDH. Exons: NM_004453.2:1-13. Variants(7): c.1448C>T, c.250G>A, c.380T>A, c.524G>A, c.1130T>C, c.524G>T, c.2T>C
Glutathione Synthetase Deficiency
Condition Gene/Varient
Glutathione Synthetase Deficiency Gene:GSS. Exons: NM_000178.2:2-13. Variants(6): c.4delG, c.847C>T, c.799C>T, c.656A>G, c.491G>A, c.656A>C
Glycogen Storage Disease Type Ia
Condition Gene/Varient
Glycogen Storage Disease Type Ia Gene:G6PC. Exons: NM_000151.3:1-5. Variants(12): c.1039C>T, c.247C>T, c.370G>A, c.229T>C, c.551G>A, c.248G>A, c.883C>T, c.328G>A, c.380_381insTA, c.562G>C, c.497T>G, c.113A>T
Glycogen Storage Disease Type Ib/Ic
Condition Gene/Varient
Glycogen Storage Disease Type Ib/Ic Gene:SLC37A4. Exons: NM_001164278.1:3-11. Variants(9): c.1108_1109delCT, c.1129G>T, c.83G>A, c.352T>C, c.1309C>T, c.1082G>A, c.706_708delGTG, c.287G>A, c.1081G>T
Glycogen Storage Disease Type II
Condition Gene/Varient
Glycogen Storage Disease Type II Gene:GAA. Exons: NM_000152.3:2-20. Variants(132): c.1843G>A, c.1636+5G>C, c.1856G>A, c.1798C>T, c.271delG, c.1115A>T, c.1796C>A, c.482_483delCC, c.896T>G, c.1333G>C, c.1826dupA, c.1703A>T, c.784G>A, c.1552- 3C>G, c.1935C>A, c.546G>T, c.923A>C, c.1222A>G, c.1064T>C, c.2741delAinsCAG, c.2269C>T, c.1548G>A, c.1210G>A, c.692+1G>C, c.2173C>T, c.1364A>T, c.670C>T, c.2281delGinsAT, c.1755-1G>A, c.1725C>A, c.935T>G, c.340_341insT, c.643G>T, c.2012T>G, c.2380delC, c.1585_1586delTCinsGT, c.1076-1G>C, c.794delG, c.710C>T, c.1687C>T, c.2846T>A, c.1978C>T, c.2331+4A>G, c.989G>A, c.1564C>G, c.623T>C, c.1082C>T, c.1933G>A, c.1802C>G, c.971C>T, c.1432G>A, c.1905C>A, c.1735G>A, c.307T>G, c.377G>A, c.1941C>G, c.1551+1G>C, c.2185delC, c.685_686insCGGC, c.1316T>A, c.1556T>C, c.875A>G, c.2174G>C, c.1377_1379delCGA, c.2014C>T, c.2040G>A, c.2608C>T, c.1561G>A, c.2646+2T>A, c.573C>A, c.2605delG, c.2560C>T, c.1979G>A, c.1724A>C, c.716delT, c.2140delC, c.925G>A, c.2815_2816delGT, c.1120T>C, c.172C>T, c.1696T>C, c.2331+2T>C, c.1076-22T>G, c.953T>C, c.872T>C, c.2041-2A>C, c.118C>T, c.2303C>G, c.2702T>A, c.1214T>C, c.1634C>T, c.1100G>A, c.877G>A, c.1799G>A, c.1327-2A>G, c.1655T>C, c.2432delT, c.1836C>G, c.1194+2T>A, c.1326+1G>A, c.2219_2220delTG, c.1927G>A, c.2132C>G, c.1375G>A, c.854C>G, c.988T>G, c.2015G>A, c.1827delC, c.1080C>G, c.1128_1129delGGinsC, c.1942G>A, c.1438-1G>C, c.2104C>T, c.2188G>T, c.18_25delGCCCTGCT, c.2662G>T, c.379_380delTG, c.1411_1414delGAGA, c.2024_2026delACA, c.2639C>A, c.525delT, c.722_723delTT, c.1857C>G, c.1555A>G, c.1441T>C, c.1309C>T, c.309C>A, c.1456G>C, c.399C>A, c.1124G>T, c.1437+2T>C, c.-32-3C>A
Glycogen Storage Disease Type III
Condition Gene/Varient
Glycogen Storage Disease Type III Gene:AGL. Exons: NM_000642.2:2-34. Variants(13): c.2039G>A, c.3682C>T, c.3980G>A, c.16C>T, c.4529dupA, c.4260-12A>G, c.1999delC, c.18_19delGA, c.2590C>T, c.1222C>T, c.3965delT, c.4456delT, c.4342G>C
Glycogen Storage Disease Type IV
Condition Gene/Varient
Glycogen Storage Disease Type IV Gene:GBE1. Exons: NM_000158.3:1-16. Variants(10): c.771T>A, c.1571G>A, c.986A>G, c.1883A>G, c.986A>C, c.1643G>A, c.1543C>T, c.1570C>T, c.671T>C, c.1774G>T
Glycogen Storage Disease Type IXc
Condition Gene/Varient
Glycogen Storage Disease Type IXc Gene:PHKG2. Exons: NM_000294.2:2-10. Variants(1): c.130C>T
Glycogen Storage Disease Type XI
Condition Gene/Varient
Glycogen Storage Disease Type XI Gene:LDHA. Exons: NM_005566.3:2-8. Variants(2): c.126+1G>A, c.640_641delCT
Glycogen Storage Disease Type XII
Condition Gene/Varient
Glycogen Storage Disease Type XII Gene:ALDOA. Exons: NM_000034.3:7-14. Variants(2): c.619G>A, c.386A>G
Glycogen Storage Disease Type XIII
Condition Gene/Varient
Glycogen Storage Disease Type XIII Gene:ENO3. Exons: NM_053013.3:2-12. Variants(2): c.467G>A, c.1121G>A
Glycogen Storage Disease Type XIV
Condition Gene/Varient
Glycogen Storage Disease Type XIV Gene:PGM1. Exons: NM_002633.2:1-11. Variants(2): c.1145-1G>C, c.343A>G
GM1-Gangliosidosis
Condition Gene/Varient
GM1-Gangliosidosis Gene:GLB1. Exons: NM_000404.2:1-16. Variants(14): c.622C>T, c.1772A>G, c.245C>T, c.145C>T, c.1445G>A, c.1369C>T, c.176G>A, c.601C>T, c.947A>G, c.152T>C, c.1370G>A, c.1771T>A, c.1051C>T, c.202C>T
GM2-Gangliosidosis, AB variant
Condition Gene/Varient
GM2-Gangliosidosis, AB variant Gene:GM2A. Exons: NM_000405.4:1-4. Variants(4): c.410delA, c.160G>T, c.412T>C, c.262_264delAAG
GNE-Related Myopathy
Condition Gene/Varient
GNE-Related Myopathy Gene:GNE. Exons: NM_005476.5:2-12. Variants(6): c.1727G>A, c.737G>A, c.1714G>T, c.2086G>A, c.2135T>C, c.909T>A
GRACILE Syndrome
Condition Gene/Varient
GRACILE Syndrome Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(2): c.232A>G, c.166C>T
Greenberg dysplasia
Condition Gene/Varient
Greenberg dysplasia Gene:LBR. Exons: NM_002296.3:2-14. Variants(3): c.1748G>A, c.1402delT, c.32_35delTGGT
Griscelli Syndrome Type 1
Condition Gene/Varient
Griscelli Syndrome Type 1 Gene:MYO5A. Exons: NM_000259.3:2-41. Variants(1): c.2332C>T
Griscelli Syndrome Type 2
Condition Gene/Varient
Griscelli Syndrome Type 2 Gene:RAB27A. Exons: NM_004580.4:2-6. Variants(5): c.217T>G, c.352C>T, c.259G>C, c.389T>C, c.454G>C
Guanidinoaceteate Methyltransferase Deficiency
Condition Gene/Varient
Guanidinoaceteate Methyltransferase Deficiency Gene:GAMT. Exons: NM_000156.5:2-6. Variants(1): c.506G>A
Gyrate Atrophy Of the Choroid And Retina
Condition Gene/Varient
Gyrate Atrophy Of the Choroid And Retina Gene:OAT. Exons: NM_000274.3:2-10. Variants(25): c.1172G>A, c.952delG, c.824G>A, c.596C>A, c.159delC, c.627T>A, c.897C>G, c.1201G>T, c.278G>T, c.3G>A, c.1276C>T, c.268C>G, c.994G>A, c.952G>A, c.1180T>C, c.677C>T, c.955C>T, c.1205T>C, c.539G>C, c.1250C>T, c.1186C>T, c.901-2A>G, c.192_193delAG, c.533G>A, c.812G>A
HADHA related Trifunctional Protein Deficiency
Condition Gene/Varient
HADHA related Trifunctional Protein Deficiency Gene:HADHA. Exons: NM_000182.4:1-20. Variants(1): c.1793_1794delAT
HADHB related Trifunctional Protein Deficiency
Condition Gene/Varient
HADHB related Trifunctional Protein Deficiency Gene:HADHB. Exons: NM_000183.2:2-16. Variants(2): c.1331G>A, c.1364T>G
HARP Syndrome
Condition Gene/Varient
HARP Syndrome Gene:PANK2. Exons: NM_153638.2:1-7. Variants(2): c.1441C>T, c.1413-1G>T
Hemophilia A
Condition Gene/Varient
HARP Syndrome Gene:F8. Exons: NM_000132.3:1-26. Variants(508): c.1498delA, c.680G>A, c.4770T>A, c.541G>A, c.1009+1G>A, c.755_756delCA, c.6350T>G, c.5562G>A, c.1311delG, c.5219+1G>A, c.1520C>G, c.524A>G, c.5894G>T, c.5561G>A, c.3385delC, c.5904C>A, c.670+5G>A, c.242C>A, c.6967C>G, c.2048A>G, c.3619_3622delCACA, c.5981T>C, c.1538-2A>G, c.1420G>A, c.6743G>C, c.6115+4A>G, c.6464_6465delAA, c.2939delG, c.5665C>T, c.5452G>T, c.195C>A, c.1357G>T, c.1718G>A, c.1831C>T, c.6084delG, c.6325C>T, c.1325A>G, c.1026T>A, c.935T>C, c.1266_1270delTGACA, c.729delT, c.4483delG, c.6226G>T, c.1750delC, c.6193T>C, c.4339delG, c.5389C>T, c.6393G>A, c.1230_1232delGGA, c.6724-1G>A, c.658G>C, c.2384_2388delGAACA, c.144-2A>G, c.901C>T
Intron 22 inversion, Intron 1 inversion Hemophilia B
Condition Gene/Varient
Intron 22 inversion, Intron 1 inversion Hemophilia B Gene:F9. Exons: NM_000133.3:1-8. Variants(301): c.392-2A>G, c.60delA, c.1295G>A, c.1278delT, c.985delA, c.1342delT, c.1024delA, c.420A>T, c.272A>G, c.464G>A, c.520+2T>G, c.162G>C, c.545_546delCT, c.505T>C, c.281G>T, c.268C>T, c.774T>G, c.1256T>A, c.1067G>A, c.422G>A, c.407T>C, c.907delC, c.400T>C, c.174delG, c.80_83delAATG, c.1322A>G, c.229delG, c.782G>A, c.1173T>A, c.1097C>A, c.698C>A, c.280G>A, c.501G>T, c.735delT, c.572G>A, c.1136G>A, c.50T>A, c.260T>G, c.941A>G, c.416G>A, c.219A>C, c.914A>G, c.263G>A, c.284delA, c.179_180delTT, c.155T>C, c.237A>C, c.392-1G>T, c.534_535delTG, c.487dupC, c.679G>T, c.724-2A>G, c.990C>A, c.1031T>A, c.1187G>A, c.758G>A, c.344A>G, c.681_682insT, c.128G>A, c.317G>A, c.205T>C, c.781T>C, c.1070G>A, c.757G>A, c.1220G>A, c.138G>C, c.350G>A, c.862G>T, c.349T>A, c.412A>C, c.1361T>C, c.688G>A, c.881G>A, c.936C>A, c.127C>T, c.1064G>A, c.754T>C, c.603T>G, c.1142C>A, c.88G>A, c.1105C>G, c.1275A>C, c.214G>C, c.482A>G, c.236A>C, c.1068G>A, c.173G>A, c.1018G>T, c.305G>A, c.1235G>A, c.1301_1302delAG, c.278-3A>G, c.277G>A, c.687_689delTGG, c.1023C>A, c.278-12C>T, c.1304G>A, c.1025C>A, c.1146T>A, c.277+5G>C, c.427C>G, c.909delC, c.423C>A, c.478G>A, c.786T>G, c.547_548delGT, c.109G>A, c.1293G>A, c.967_974delGAACCCTT, c.682G>C, c.413A>G, c.775G>T, c.1144T>C, c.520+13A>G, c.83G>A, c.1088G>A, c.247_248insA, c.96delT, c.172G>A, c.1323T>G, c.722delA, c.917A>G, c.1213G>A, c.1343_1350delCCCGGTAT, c.838+2T>G, c.55delC, c.862delG, c.1188T>A, c.796G>A, c.1151G>C, c.892C>T, c.804T>G, c.454A>T, c.655C>T, c.1084A>G, c.1346G>A, c.1276A>C, c.471T>A, c.493G>T, c.1349A>G, c.291T>G, c.1325G>A, c.1274T>G, c.1109A>C, c.838+1G>C, c.533G>A, c.799delC, c.1357T>A, c.947T>C, c.157G>A, c.253-2A>G, c.676C>G, c.536G>A, c.827_828delCA, c.1219T>A, c.165_169delTGTTC, c.1181T>A, c.1185C>G, c.155delT, c.622G>T, c.212T>C, c.185_188delGAGA, c.874delC, c.223C>T, c.946A>T, c.1318A>G, c.689_691delGAG, c.905A>G, c.856_858delGAG, c.322delT, c.532T>C, c.723+2T>C, c.1328T>C, c.707G>A, c.199G>A, c.277+4A>G, c.800A>G, c.1217C>G, c.755G>A, c.1147C>A, c.799C>T, c.484C>A, c.373G>A, c.1241C>A, c.389delT, c.556delA, c.401G>A, c.324C>A, c.316G>A, c.89-6T>G, c.1231A>G, c.509G>A, c.370G>A, c.88+5G>A, c.145T>C, c.1151_1154delGATC, c.1150C>T, c.922delG, c.1244A>G, c.835G>A, c.813delT, c.1145G>A, c.1132G>T, c.1240C>A, c.83delG, c.723G>C, c.1058T>C, c.224G>A, c.1306G>A, c.479G>A, c.127delC, c.1294G>A, c.278A>G, c.1135C>G, c.1174A>G, c.252+5G>A, c.415G>A, c.1175delA, c.413delA, c.1129G>T, c.352T>A, c.226G>A, c.279T>A, c.1113C>A, c.59T>A, c.1183T>C, c.418dupA, c.568_569delAC, c.133_134insT, c.720G>A, c.808G>T, c.466T>C, c.942T>G, c.197A>T, c.219_220insA, c.253-3T>G, c.723+1G>T, c.1169T>C, c.252+1G>A, c.1069G>A, c.292G>T, c.957_958delGGinsC, c.1139C>A, c.1270T>C, c.677G>A, c.724-1G>A, c.1077_1078delCT, c.161_162delAG, c.932delA, c.761G>A, c.1348T>C, c.659delC, c.1324G>A, c.391+1G>C, c.719G>A, c.520+1G>T, c.1066T>A, c.1258G>T, c.783G>T, c.1297G>A, c.235G>A, c.287A>C, c.88+5_88+8delGTTT, c.449delA, c.414T>A, c.356G>A, c.470G>A, c.206G>A, c.82T>C, c.871G>A, c.328G>A, c.944A>G, c.1358G>A, c.148G>A, c.1189G>C, c.1168A>T, c.191G>A, c.278-1G>A, c.163T>A, c.392delA, c.668delA, c.278-2A>T, c.184A>T, c.286C>T, c.1052G>A, c.785T>C, c.659C>A, c.353G>A, c.1138G>A, c.190T>C, c.1074_1075delAG, c.1182G>A, c.434G>A, c.956T>C, c.453_454delCA, c.277+2T>C, c.508T>C, c.30delA, c.1183T>A, c.255_256delTG, c.391+2T>C
Hereditary Fructose Intolerance
Condition Gene/Varient
Hereditary Fructose Intolerance Gene:ALDOB. Exons: NM_000035.3:2-9. Variants(7): c.10C>T, c.1005C>G, c.720C>A, c.178C>T, c.524C>A, c.360_363delCAAA, c.448G>C
Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum
Condition Gene/Varient
Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum Gene:SLC12A6. Exons: NM_133647.1:1- 25. Variants(5): c.619C>T, c.2436+1delG, c.3031C>T, c.1584_1585delCTinsG, c.2023C>T
Hereditary Sensory and Autonomic Neuropathy IV
Condition Gene/Varient
Hereditary Sensory and Autonomic Neuropathy IV Gene:NTRK1. Exons: NM_001012331.1:2-16. Variants(9): c.1076A>G, c.1711G>C, c.1741A>G, c.2066C>T, c.851-33T>A, c.1908_1909insT, c.1709delT, c.1834G>T, c.2321G>C
Hermansky-Pudlak Syndrome 1
Condition Gene/Varient
Hermansky-Pudlak Syndrome 1 Gene:HPS1. Exons: NM_000195.3:3-20. Variants(6): c.1472_1487dupCCAGCAGGGGAGGCCC, c.397G>T, c.972delC, c.398+5G>A, c.972_973insC, c.1996G>T
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency
Condition Gene/Varient
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency Gene:CBS. Exons: NM_000071.2:3-17. Variants(12): c.1330G>A, c.341C>T, c.430G>A, c.434C>T, c.502G>A, c.572C>T, c.1058C>T, c.797G>A, c.919G>A, c.1397C>T, c.1150A>G, c.1265C>T
Hydrolethalus Syndrome 1
Condition Gene/Varient
Hydrolethalus Syndrome 1 Gene:HYLS1. Exons: NM_145014.2:4. Variants(1): c.632A>G
Hydrolethalus Syndrome 2
Condition Gene/Varient
Hydrolethalus Syndrome 2 Gene:KIF7. Exons: NM_198525.2:2-4,6-19. Variants(1): c.2896_2897delGC
Hyper-IgD syndrome
Condition Gene/Varient
Hyper-IgD syndrome Gene:MVK. Exons: NM_000431.2:2-11. Variants(5): c.803T>C, c.829C>T, c.1129G>A, c.59A>C, c.494C>T
Hypermethioninemia
Condition Gene/Varient
Hypermethioninemia Gene:MAT1A. Exons: NM_000429.2:1-9. Variants(9): c.1006G>A, c.164C>A, c.966T>G, c.790C>T, c.914T>C, c.1043_1044delTG, c.538_539insTG, c.1070C>T, c.827_828insG
Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome
Condition Gene/Varient
Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome Gene:SLC25A15. Exons: NM_014252.3:2-7. Variants(11): c.658G>A, c.562_564delTTC, c.824G>A, c.79G>A, c.815C>T, c.212T>A, c.535C>T, c.110T>G, c.95C>G, c.538G>A, c.569G>A
Hyperprolinemia Type II
Condition Gene/Varient
Hyperprolinemia Type II Gene:ALDH4A1. Exons: NM_003748.3:2-15. Variants(1): c.1055C>T
Hypomagnesemia 5
Condition Gene/Varient
Hypomagnesemia 5 Gene:CLDN19. Exons: NM_148960.2:1-5. Variants(3): c.169C>G, c.59G>A, c.269T>C
Hypomyelination and Congenital Cataract
Condition Gene/Varient
Hypomyelination and Congenital Cataract Gene:FAM126A. Exons: NM_032581.3:2-11. Variants(1): c.158T>C
Hypoparathyroidism-Retardation-Dysmorphism Syndrome
Condition Gene/Varient
Hypoparathyroidism-Retardation-Dysmorphism Syndrome Gene:TBCE. Exons: NM_003193.3:2-17. Variants(2): c.1113T>A, c.66_67delAG
Hypophosphatasia
Condition Gene/Varient
Hypophosphatasia Gene:ALPL. Exons: NM_000478.4:2-12. Variants(20): c.979T>C, c.746G>T, c.211C>T, c.881A>C, c.535G>A, c.1366G>A, c.620A>C, c.571G>A, c.1559delT, c.1133A>T, c.98C>T, c.814C>T, c.346G>A, c.892G>A, c.1306T>C, c.1250A>G, c.1001G>A, c.526G>A, c.407G>A, c.212G>C
Hypotrichosis, congenital, with juvenile macular dystrophy
Condition Gene/Varient
Hypotrichosis, congenital, with juvenile macular dystrophy Gene:CDH3. Exons: NM_001793.4:1-16. Variants(1): c.981delG
Ichthyosis Follicularis-Atrichia-Photophobia Syndrome
Condition Gene/Varient
Ichthyosis Follicularis-Atrichia-Photophobia Syndrome Gene:MBTPS2. Exons: NM_015884.3:1-11. Variants(4): c.1286G>A, c.677G>T, c.1424T>C, c.261G>A IGF1
Deficiency
Condition Gene/Varient
Deficiency Gene:IGF1. Exons: NM_000618.3:1-4. Variants(1): c.274G>A
Infantile Sialic acid Storage Disorder
Condition Gene/Varient
Infantile Sialic acid Storage Disorder Gene:SLC17A5. Exons: NM_012434.4:1-11. Variants(3): c.1001C>G, c.548A>G, c.918T>G
Infantile Striatonigral Degeneration
Condition Gene/Varient
Infantile Striatonigral Degeneration Gene:NUP62. Exons: NM_153719.3:3. Variants(1): c.1172A>C
Infantile-Onset Spinocerebellar Ataxia
Condition Gene/Varient
Infantile Striatonigral Degeneration Gene:C10orf2. Exons: NM_021830.4:1-5. Variants(5): c.955A>G, c.1370C>T, c.1287C>T, c.952G>A, c.1523A>G
Isolated Growth Hormone Deficiency
Condition Gene/Varient
Isolated Growth Hormone Deficiency Gene:BTK. Exons: NM_000061.2:2-19. Variants(2): c.1625T>C, c.1125T>G
Isolated Microphthalmia 3
Condition Gene/Varient
Isolated Microphthalmia 3 Gene:RAX. Exons: NM_013435.2:1-2. Variants(3): c.575G>A, c.439C>T, c.909C>G
Isolated Microphthalmia 5
Condition Gene/Varient
Isovaleric Acidemia Gene:IVD. Exons: NM_002225.3:1-12. Variants(5): c.941C>T, c.1188delT, c.157C>T, c.605G>T, c.134T>C
ITGA6-Related Epidermolysis Bullosa with Pyloric Atresia
Condition Gene/Varient
ITGA6-Related Epidermolysis Bullosa with Pyloric Atresia Gene:ITGA6. Exons: NM_000210.2:1-25. Variants(1): c.791delC
ITGB4-Related Epidermolysis Bullosa with Pyloric Atresia
Condition Gene/Varient
ITGB4-Related Epidermolysis Bullosa with Pyloric Atresia Gene:ITGB4. Exons: NM_001005731.1:2-39. Variants(14): c.112T>C, c.1684T>C, c.3841C>T, c.4410delG, c.4433G>A, c.467T>C, c.3977-19T>A, c.3674G>A, c.3801_3802insT, c.1150delG, c.3793+1G>A, c.1660C>T, c.182G>A, c.2792G>A
Johanson-Blizzard Syndrome
Condition Gene/Varient
Johanson-Blizzard Syndrome Gene:UBR1. Exons: NM_174916.2:1-47. Variants(2): c.407A>G, c.1537C>T
Joubert Syndrome 1
Condition Gene/Varient
Joubert Syndrome 1 Gene:INPP5E. Exons: NM_019892.4:1-10. Variants(4): c.1132C>T, c.1543C>T, c.1688G>A, c.1304G>A
Joubert Syndrome 10
Condition Gene/Varient
Joubert Syndrome 10 Gene:OFD1. Exons: NM_003611.2:1-23. Variants(2): c.2767delG, c.2844_2850delAGACAAA
Joubert syndrome 13
Condition Gene/Varient
Joubert syndrome 13 Gene:TCTN1. Exons: NM_001082538.2:1-14. Variants(1): c.221-2A>
G Joubert Syndrome 2
Condition Gene/Varient
G Joubert Syndrome 2 Gene:TMEM216. Exons: NM_001173990.2:1-5. Variants(2): c.218G>A, c.218G>T
Joubert Syndrome 3
Condition Gene/Varient
Joubert Syndrome 3 Gene:AHI1. Exons: NM_017651.4:3-28. Variants(10): c.1328T>A, c.1303C>T, c.985C>T, c.2168G>A, c.1052G>T, c.1765C>T, c.1484G>A, c.3263_3264delGG, c.1051C>T, c.2370dupT
Joubert Syndrome 5
Condition Gene/Varient
Joubert Syndrome 5 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(5): c.21G>T, c.5668G>T, c.2249T>G, c.4723A>T, c.4656delA
Joubert Syndrome 6
Condition Gene/Varient
Joubert Syndrome 6 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(3): c.755T>C, c.130C>T, c.1538A>G
Joubert Syndrome 7
Condition Gene/Varient
Joubert Syndrome 7 Gene:RPGRIP1L. Exons: NM_015272.2:2-22,24-27. Variants(7): c.1975T>C, c.697A>T, c.1843A>C, c.2269delA, c.2413C>T, c.757C>T, c.2050C>T
Joubert Syndrome 8
Condition Gene/Varient
Joubert Syndrome 8 Gene:ARL13B. Exons: NM_182896.2:1-10. Variants(3): c.236G>A, c.598C>T, c.246G>A
Joubert Syndrome 9
Condition Gene/Varient
Joubert Syndrome 9 Gene:CC2D2A. Exons: NM_001080522.2:3-38. Variants(5): c.4582C>T, c.3289delG, c.4667A>T, c.3364C>T, c.2848C>T
Kanzaki Disease
Condition Gene/Varient
Kanzaki Disease Gene:NAGA. Exons: NM_000262.2:1-9. Variants(3): c.985C>T, c.577G>T, c.986G>A
KCNJ11-Related Congenital Hyperinsulinism
Condition Gene/Varient
KCNJ11-Related Congenital Hyperinsulinism Gene:KCNJ11. Exons: NM_000525.3:1. Variants(4): c.761C>T, c.440T>C, c.776A>G, c.36C>A
Kelley-Seegmiller Syndrome
Condition Gene/Varient
Kelley-Seegmiller Syndrome Gene:HPRT1. Exons: NM_000194.2:2-9. Variants(4): c.193C>T, c.602A>G, c.239A>T, c.329C>T
Knobloch syndrome
Condition Gene/Varient
Knobloch syndrome Gene:COL18A1. Exons: NM_030582.3:1-41. Variants(2): c.3517_3518delCC, c.3618_3619delGG
Krabbe Disease
Condition Gene/Varient
Krabbe Disease Gene:GALC. Exons: NM_000153.3:2-17. Variants(5): c.1153G>T, c.1586C>T, c.1630G>A, c.857G>A, c.1796T>G
L1 Syndrome
Condition Gene/Varient
L1 Syndrome Gene:L1CAM. Exons: NM_000425.3:1-28. Variants(14): c.536T>G, c.924C>T, c.1792G>A, c.1354G>A, c.719C>T, c.3489_3490delTG, c.2432-19A>C, c.2254G>A, c.551G>A, c.791G>A, c.3581C>T, c.1108G>A, c.1939+5G>A, c.3458-1G>C LAMA2-Related Congenital Muscular Dystrophy. Gene:LAMA2. Exons: NM_000426.3:1-65. Variants(10): c.2098_2099delTT, c.8314delA, c.2901C>A, c.825delC, c.3718C>T, c.7732C>T, c.2049_2050delAG, c.7147C>T, c.9253C>T, c.4645C>T
LAMA3-Related Junctional Epidermolysis Bullosa
Condition Gene/Varient
LAMA3-Related Junctional Epidermolysis Bullosa Gene:LAMA3. Exons: NM_000227.3:1-38. Variants(4): c.2116A>T, c.335delG, c.4135C>T, c.1981C>T
LAMB3-Related Junctional Epidermolysis Bullosa
Condition Gene/Varient
LAMB3-Related Junctional Epidermolysis Bullosa Gene:LAMB3. Exons: NM_000228.2:2-23. Variants(10): c.1587_1588delAG, c.496C>T, c.727C>T, c.2806C>T, c.904delT, c.1903C>T, c.1830G>A, c.1438_1442delCCGTG, c.628G>A, c.124C>T
LAMC2-Related Junctional Epidermolysis Bullosa
Condition Gene/Varient
LAMC2-Related Junctional Epidermolysis Bullosa Gene:LAMC2. Exons: NM_005562.2:1-23. Variants(8): c.1065C>G, c.1659C>A, c.3512_3513insA, c.2137_2143delCAGAACC, c.405-1G>A, c.1067-1G>A, c.283C>T, c.733C>T
Lathosterolosis
Condition Gene/Varient
Lathosterolosis Gene:SC5DL. Exons: NM_006918.4:2-5. Variants(1): c.86G>A
Leber Congenital Amaurosis 1
Condition Gene/Varient
Leber Congenital Amaurosis 1 Gene:GUCY2D. Exons: NM_000180.3:3-19. Variants(3): c.1694T>C, c.2945delG, c.622delC
Leber congenital amaurosis 10
Condition Gene/Varient
Leber congenital amaurosis 10 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(1): c.3185delT
Leber Congenital Amaurosis 13
Condition Gene/Varient
Leber Congenital Amaurosis 13 Gene:RDH12. Exons: NM_152443.2:3-9. Variants(13): c.379G>T, c.377C>T, c.295C>A, c.451C>G, c.152T>A, c.523T>C, c.184C>T, c.146C>T, c.806_810delCCCTG, c.464C>T, c.565C>T, c.677A>G, c.451C>A
Leber Congenital Amaurosis 14
Condition Gene/Varient
Leber Congenital Amaurosis 14 Gene:LRAT. Exons: NM_004744.3:2-3. Variants(2): c.525T>A, c.217_218delAT
Leber Congenital Amaurosis 15
Condition Gene/Varient
Leber Congenital Amaurosis 15 Gene:TULP1. Exons: NM_003322.3:1-15. Variants(2): c.1204G>T, c.1198C>T
Leber Congenital Amaurosis 16
Condition Gene/Varient
Leber Congenital Amaurosis 16 Gene:KCNJ13. Exons: NM_002242.4:2-3. Variants(2): c.496C>T, c.722T>C
Leber Congenital Amaurosis 2
Condition Gene/Varient
Leber Congenital Amaurosis 2 Gene:RPE65. Exons: NM_000329.2:1-14. Variants(4): c.700C>T, c.907A>T, c.1067delA, c.1292A>G
Leber Congenital Amaurosis 4
Condition Gene/Varient
Leber Congenital Amaurosis 4 Gene:AIPL1. Exons: NM_014336.3:1-6. Variants(5): c.244C>T, c.715T>C, c.905G>T, c.589G>C, c.834G>A
Leber Congenital Amaurosis 7
Condition Gene/Varient
Leber Congenital Amaurosis 7 Gene:CRX. Exons: NM_000554.4:2-4. Variants(2): c.268C>T, c.529delG
Leber Congenital Amaurosis 8
Condition Gene/Varient
Leber Congenital Amaurosis 8 Gene:CRB1. Exons: NM_201253.2:1-12. Variants(4): c.2688T>A, c.2843G>A, c.3299T>G, c.3997G>T
Leber Congenital Amaurosis 9
Condition Gene/Varient
Leber Congenital Amaurosis 9 Gene:NMNAT1. Exons: NM_022787.3:2-5. Variants(9): c.769G>A, c.457C>G, c.817A>G, c.25G>A, c.619C>T, c.710G>T, c.451G>T, c.507G>A, c.838T>C
Leigh Syndrome, French-Canadian Type
Condition Gene/Varient
Leigh Syndrome, French-Canadian Type Gene:LRPPRC. Exons: NM_133259.3:2-38. Variants(2): c.1061C>T, c.3830_3839delGTGGTGCAATinsAG
Lesch-Nyhan Syndrome
Condition Gene/Varient
Lesch-Nyhan Syndrome Gene:HPRT1. Exons: NM_000194.2:2-9. Variants(4): c.508C>T, c.170T>C, c.143G>A, c.212_213insG
Lethal Acantholytic Epidermolysis Bullosa
Condition Gene/Varient
Lethal Acantholytic Epidermolysis Bullosa Gene:DSP. Exons: NM_004415.2:1-24. Variants(2): c.6370_6371delCT, c.5800C>T
Lethal Congenital Contracture Syndrome 1
Condition Gene/Varient
Lethal Congenital Contracture Syndrome 1 Gene:GLE1. Exons: NM_001003722.1:1-16. Variants(2): c.1849G>A, c.2051T>C
LIG4 Syndrome
Condition Gene/Varient
LIG4 Syndrome Gene:LIG4. Exons: NM_002312.3:2. Variants(4): c.1738C>T, c.1406G>A, c.2440C>T, c.833G>A
Limb-Girdle Muscular Dystrophy Type 2A
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy Type 2A Gene:CAPN3. Exons: NM_000070.2:1-24. Variants(9): c.956C>T, c.1469G>A, c.1795_1796insA, c.257C>T, c.2362_2363delAGinsTCATCT, c.328C>T, c.1715G>A, c.550delA, c.2306G>A
Limb-Girdle Muscular Dystrophy type 2B
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2B Gene:DYSF. Exons: NM_003494.3:1-35,37-55. Variants(5): c.2372C>G, c.5201A>G, c.895G>A, c.200_201delTGinsAT, c.1873G>T
Limb-Girdle Muscular Dystrophy type 2C
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2C Gene:SGCG. Exons: NM_000231.2:2-8. Variants(2): c.787G>A, c.848G>A
Limb-Girdle Muscular Dystrophy type 2D
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2D Gene:SGCA. Exons: NM_000023.2:1-9. Variants(4): c.293G>A, c.574C>T, c.739G>A, c.229C>T
Limb-Girdle Muscular Dystrophy type 2E
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2E Gene:SGCB. Exons: NM_000232.4:2-6. Variants(7): c.272G>T, c.452C>G, c.299T>A, c.323T>G, c.552T>G, c.341C>T, c.272G>C
Limb-Girdle Muscular Dystrophy type 2G
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2G Gene:TCAP. Exons: NM_003673.3:1-2. Variants(1): c.157C>T
Limb-Girdle Muscular Dystrophy type 2H
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2H Gene:TRIM32. Exons: NM_012210.3:2. Variants(3): c.1560delC, c.1181G>A, c.1459G>A
Limb-Girdle Muscular Dystrophy Type 2L
Condition Gene/Varient
Limb-Girdle Muscular Dystrophy Type 2L Gene:ANO5. Exons: NM_213599.2:1-22. Variants(6): c.2311_2312delCA, c.1407+5G>A, c.191_192insA, c.1295C>G, c.2272C>T, c.692G>T
Lipoid Congenital Adrenal Hyperplasia
Condition Gene/Varient
Lipoid Congenital Adrenal Hyperplasia Gene:STAR. Exons: NM_000349.2:1-7. Variants(8): c.562C>T, c.650G>C, c.545G>A, c.772C>T, c.559G>A, c.577C>T, c.749G>A, c.545G>T
Lissencephaly with Cerebellar Hypoplasia
Condition Gene/Varient
Lissencephaly with Cerebellar Hypoplasia Gene:RELN. Exons: NM_005045.3:1-65. Variants(1): c.5615-1G>A Long-Chain
Hydroxyacyl-Coa Dehydrogenase Deficiency
Condition Gene/Varient
Hydroxyacyl-Coa Dehydrogenase Deficiency Gene:HADHA. Exons: NM_000182.4:1-20. Variants(4): c.2132_2133insC, c.1528G>C, c.1132C>T, c.1678C>T
Lujan-Fryns Syndrome
Condition Gene/Varient
Lujan-Fryns Syndrome Gene:MED12. Exons: NM_005120.2:1-41,43-45. Variants(1): c.3020A>
G Macular Corneal Dystrophy
Condition Gene/Varient
G Macular Corneal Dystrophy Gene:CHST6. Exons: NM_021615.4:3. Variants(2): c.609C>A, c.599T>G
Malonyl-CoA Decarboxylase Deficiency
Condition Gene/Varient
Malonyl-CoA Decarboxylase Deficiency Gene:MLYCD. Exons: NM_012213.2:2-5. Variants(1): c.560C>G
Mandibuloacral Dysplasia with type A lipodystrophy
Condition Gene/Varient
Mandibuloacral Dysplasia with type A lipodystrophy Gene:ZMPSTE24. Exons: NM_005857.4:1-10. Variants(5): c.1018T>C, c.743C>T, c.1349G>A, c.121C>T, c.1085_1086insT
Mandibuloacral Dysplasia with type B lipodystrophy
Condition Gene/Varient
Mandibuloacral Dysplasia with type B lipodystrophy Gene:LMNA. Exons: NM_170707.3:1-12. Variants(6): c.1586C>T, c.1626G>C, c.1411C>T, c.1318G>A, c.1580G>A, c.1579C>T
Maple Syrup Urine Disease Type 1A
Condition Gene/Varient
Maple Syrup Urine Disease Type 1A Gene:BCKDHA. Exons: NM_000709.3:1-9. Variants(3): c.1312T>A, c.117delC, c.868G>A
Maple Syrup Urine Disease Type 1B
Condition Gene/Varient
Maple Syrup Urine Disease Type 1B Gene:BCKDHB. Exons: NM_183050.2:1-10. Variants(6): c.356T>G, c.1039-7_1039-4delTCTG, c.832G>A, c.616C>T, c.1114G>T, c.548G>C
Maple Syrup Urine Disease Type 2
Condition Gene/Varient
Maple Syrup Urine Disease Type 2 Gene:DBT. Exons: NM_001918.3:1-11. Variants(5): c.1355A>G, c.1448G>T, c.294C>G, c.581C>G, c.827T>G
Maple Syrup Urine Disease Type 3
Condition Gene/Varient
Maple Syrup Urine Disease Type 3 Gene:DLD. Exons: NM_000108.3:1-14. Variants(3): c.105_106insA, c.685G>T, c.1483A>G
Marinesco-Sj?gren syndrome
Condition Gene/Varient
Marinesco-Sj?gren syndrome Gene:SIL1. Exons: NM_022464.4:2-10. Variants(3): c.1370T>C, c.1312C>T, c.331C>T G
Martsolf Syndrome
Condition Gene/Varient
Martsolf Syndrome Gene:RAB3GAP2. Exons: NM_012414.3:1-35. Variants(1): c.3154G>T
McKusick-Kaufman Syndrome
Condition Gene/Varient
McKusick-Kaufman Syndrome Gene:MKKS. Exons: NM_018848.3:3-6. Variants(3): c.724G>T, c.110A>G, c.250C>T
Meckel Syndrome 1
Condition Gene/Varient
Meckel Syndrome 1 Gene:MKS1. Exons: NM_017777.3:1-18. Variants(2): c.51_55dupCCGGG, c.80+2T>C
Meckel Syndrome 10
Condition Gene/Varient
Meckel Syndrome 10 Gene:B9D2. Exons: NM_030578.3:2-4. Variants(1): c.301A>
Meckel Syndrome 2
Condition Gene/Varient
Meckel Syndrome 2 Gene:TMEM216. Exons: NM_001173990.2:1-5. Variants(3): c.341T>G, c.253C>T, c.230G>C
Meckel Syndrome 3
Condition Gene/Varient
Meckel Syndrome 3 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(2): c.1127A>C, c.622A>
T Meckel Syndrome 4
Condition Gene/Varient
T Meckel Syndrome 4 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(2): c.384_387delTAGA, c.613C>T
Meckel Syndrome 5
Condition Gene/Varient
Meckel Syndrome 5 Gene:RPGRIP1L. Exons: NM_015272.2:2-22,24-27. Variants(3): c.2614C>T, c.1033C>T, c.394A>T
MECP2-Related Severe Neonatal Encephalopathy
Condition Gene/Varient
MECP2-Related Severe Neonatal Encephalopathy Gene:MECP2. Exons: NM_004992.3:2-4. Variants(6): c.410A>G, c.964C>T, c.419C>T, c.1282G>A, c.1180G>T, c.674C>T
Megalencephalic Leukoencephalopathy with Subcortical Cysts 1
Condition Gene/Varient
Megalencephalic Leukoencephalopathy with Subcortical Cysts 1 Gene:MLC1. Exons: NM_015166.3:2-12. Variants(8): c.278C>T, c.422A>G, c.274C>T, c.839C>T, c.423C>A, c.206C>T, c.135_136insC, c.178-10T>A
Metachromatic Leukodystrophy due to Arylsulfatase A
Condition Gene/Varient
Metachromatic Leukodystrophy due to Arylsulfatase A Gene:ARSA. Exons: NM_000487.5:1-8. Variants(12): c.1283C>T, c.769G>C, c.465+1G>A, c.257G>A, c.1401_1411delGTTAGACGCAG, c.739G>A, c.1232C>T, c.1210+1G>A, c.293C>T, c.641C>T, c.542T>G, c.302G>A
Metachromatic Leukodystrophy due to Saposin B Deficiency
Condition Gene/Varient
Metachromatic Leukodystrophy due to Saposin B Deficiency Gene:PSAP. Exons: NM_002778.2:1-14. Variants(2): c.722G>C, c.643A>C
Methylmalonic Aciduria and Homocystinuria CblC type
Condition Gene/Varient
Methylmalonic Aciduria and Homocystinuria CblC type Gene:MMACHC. Exons: NM_015506.2:1-4. Variants(6): c.331C>T, c.394C>T, c.440G>C, c.482G>A, c.347T>C, c.271dupA
Methylmalonic Aciduria and Homocystinuria CblD type
Condition Gene/Varient
Methylmalonic Aciduria and Homocystinuria CblD type Gene:MMADHC. Exons: NM_015702.2:2-8. Variants(7): c.746A>G, c.748C>T, c.545C>A, c.160C>T, c.776T>C, c.419dupA, c.57_64delCTCTTTAG
Mevalonic Aciduria
Condition Gene/Varient
Mevalonic Aciduria Gene:MVK. Exons: NM_000431.2:2-11. Variants(3): c.1000G>A, c.902A>C, c.928G>A
Microphthalmia with coloboma 8/Syndromic Microphthalmia 9
Condition Gene/Varient
Microphthalmia with coloboma 8/Syndromic Microphthalmia 9 Gene:STRA6. Exons: NM_022369.3:2-19. Variants(12): c.527_528insG, c.1678G>C, c.910_911delGGinsAA, c.1931C>T, c.878C>T, c.1521-1G>A, c.52_53delTAinsC, c.1964G>A, c.1963C>T, c.147delC, c.69G>A, c.277_278insCC
Minicore Myopathy With External Ophthalmoplegia
Condition Gene/Varient
Minicore Myopathy With External Ophthalmoplegia Gene:RYR1. Exons: NM_000540.2:1-90,92-106. Variants(6): c.1739_1742dupATCA, c.10343C>T, c.7268T>A, c.325C>T, c.14365-2A>T, c.5726_5727delAG
Mitochondrial Complex III Deficiency Nuclear Type 1
Condition Gene/Varient
Mitochondrial Complex III Deficiency Nuclear Type 1 Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(7): c.830G>A, c.296C>T, c.1057G>A, c.547C>T, c.464G>C, c.148A>G, c.133C>T
Mitochondrial Complex III Deficiency nuclear Type 3
Condition Gene/Varient
Mitochondrial Complex III Deficiency nuclear Type 3 Gene:UQCRB. Exons: NM_006294.4:1-4. Variants(1): c.306_309delAAAA
Mitochondrial Complex III Deficiency nuclear Type 4
Condition Gene/Varient
Mitochondrial Complex III Deficiency nuclear Type 4 Gene:UQCRQ. Exons: NM_014402.4:2-3. Variants(1): c.134C>T
Mitochondrial DNA depletion Syndrome 2
Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 2 Gene:TK2. Exons: NM_004614.4:2-10. Variants(5): c.323C>T, c.361C>A, c.159C>G, c.268C>T, c.635T>A
Mitochondrial DNA depletion Syndrome 3
Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 3 Gene:DGUOK. Exons: NM_080916.2:1-7. Variants(4): c.679G>A, c.425G>A, c.763G>T, c.313C>T
Mitochondrial DNA depletion Syndrome 6
Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 6 Gene:MPV17. Exons: NM_002437.4:2-8. Variants(5): c.498C>A, c.149G>A, c.359G>A, c.148C>T, c.70G>T
Mitochondrial DNA depletion Syndrome 9
Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 9 Gene:SUCLG1. Exons: NM_003849.3:1-8. Variants(3): c.626C>A, c.97+3G>C, c.152_153delAT
Miyoshi Myopathy
Condition Gene/Varient
Miyoshi Myopathy Gene:DYSF. Exons: NM_003494.3:1-35,37-55. Variants(7): c.895G>T, c.6124C>T, c.1555G>A, c.1813C>T, c.5713C>T, c.2997G>T, c.3137G>A
MMAA-Related Methylmalonic Acidemia
Condition Gene/Varient
MMAA-Related Methylmalonic Acidemia Gene:MMAA. Exons: NM_172250.2:2-7. Variants(4): c.503delC, c.433C>T, c.283C>T, c.620A>G
MMAB-Related Methylmalonic Acidemia
Condition Gene/Varient
MMAB-Related Methylmalonic Acidemia Gene:MMAB. Exons: NM_052845.3:1-9. Variants(3): c.548A>T, c.556C>T, c.569G>A
Mohr-Tranebjaerg Syndrome
Condition Gene/Varient
Mohr-Tranebjaerg Syndrome Gene:TIMM8A. Exons: NM_004085.3:1-2. Variants(3): c.112C>T, c.238C>T, c.198C>G
Molybdenum Cofactor Deficiency A
Condition Gene/Varient
Molybdenum Cofactor Deficiency A Gene:MOCS1. Exons: NM_005943.5:1-9. Variants(2): c.956G>A, c.217C>T
Molybdenum Cofactor Deficiency B
Condition Gene/Varient
Molybdenum Cofactor Deficiency B Gene:MOCS2. Exons: NM_176806.2:1-3. Variants(3): c.*422G>A, c.16C>T, c.*487A>C
MORM Syndrome
Condition Gene/Varient
MORM Syndrome Gene:INPP5E. Exons: NM_019892.4:1-10. Variants(1): c.1879C>T
MTHFR deficiency
Condition Gene/Varient
MTHFR deficiency Gene:MTHFR. Exons: NM_005957.4:2-12. Variants(6): c.1743G>A, c.1015T>G, c.968T>C, c.547C>T, c.1129C>T, c.971A>G
Mucolipidosis II
Condition Gene/Varient
Mucolipidosis II Gene:GNPTAB. Exons: NM_024312.4:1-21. Variants(6): c.3173C>G, c.2681G>A, c.3503_3504delTC, c.1196C>T, c.310C>T, c.3565C>T
Mucolipidosis IV
Condition Gene/Varient
Mucolipidosis IV Gene:MCOLN1. Exons: NM_020533.2:2-14. Variants(5): c.1084G>T, c.1207C>T, c.964C>T, c.304C>T, c.406-2A>G
Mucopolysaccharidosis Type I
Condition Gene/Varient
Mucopolysaccharidosis Type I Gene:IDUA. Exons: NM_000203.3:2-8,12-14. Variants(8): c.1960T>G, c.1037T>G, c.1855C>G, c.266G>A, c.1206G>A, c.1861C>T, c.208C>T, c.192C>A
Mucopolysaccharidosis Type II
Condition Gene/Varient
Mucopolysaccharidosis Type II Gene:IDS. Exons: NM_000202.5:1-2,4-9. Variants(9): c.1425G>A, c.1464G>T, c.1327C>T, c.514C>T, c.1466G>C, c.1402C>T, c.1403G>T, c.1403G>A, c.998C>T
Mucopolysaccharidosis Type IIIA
Condition Gene/Varient
Mucopolysaccharidosis Type IIIA Gene:SGSH. Exons: NM_000199.3:2-8. Variants(10): c.1105G>A, c.892T>C, c.197C>G, c.1298G>A, c.383C>T, c.449G>A, c.1339G>A, c.220C>T, c.734G>A, c.617G>C
Mucopolysaccharidosis Type IIIC
Condition Gene/Varient
Mucopolysaccharidosis Type IIIC Gene:HGSNAT. Exons: NM_152419.2:2-18. Variants(8): c.1030C>T, c.493+1G>A, c.962T>G, c.1345dupG, c.525dupT, c.1553C>T, c.848C>T, c.372-2A>G
Mucopolysaccharidosis Type IIID
Condition Gene/Varient
Mucopolysaccharidosis Type IIID Gene:GNS. Exons: NM_002076.3:1-14. Variants(4): c.1169delA, c.1063C>T, c.1226dupG, c.1168C>T
Mucopolysaccharidosis Type IVB
Condition Gene/Varient
Mucopolysaccharidosis Type IVB Gene:GLB1. Exons: NM_000404.2:1-16. Variants(6): c.1527G>T, c.818G>T, c.1313G>A, c.1223A>C, c.1444C>T, c.1498A>G
Mucopolysaccharidosis Type VI
Condition Gene/Varient
Mucopolysaccharidosis Type VI Gene:ARSB. Exons: NM_000046.3:2-8. Variants(6): c.629A>G, c.349T>C, c.410G>T, c.707T>C, c.1178A>C, c.1214G>A
Mucopolysaccharidosis Type VII
Condition Gene/Varient
Mucopolysaccharidosis Type VII Gene:GUSB. Exons: NM_000181.3:1-12. Variants(15): c.442C>T, c.646C>T, c.526C>T, c.1061C>T, c.1144C>T, c.1831C>T, c.1244+1G>A, c.1338G>A, c.1069C>T, c.1484A>G, c.1050G>C, c.1881G>T, c.1856C>T, c.1730G>T, c.1521G>A
Mulibrey Nanism
Condition Gene/Varient
Mulibrey Nanism Gene:TRIM37. Exons: NM_015294.3:1-24. Variants(14): c.860G>A, c.2056C>T, c.227T>C, c.2212delG, c.1411C>T, c.1894_1895delGA, c.965G>T, c.855_860+2delTTTCAGGT, c.1346_1347insA, c.838_842delACTTT, c.326G>C, c.1037_1040dupAGAT, c.745C>T, c.496_500delAGGAA
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A1
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A1 Gene:POMT1. Exons: NM_007171.3:2- 20. Variants(2): c.226G>A, c.907C>T
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A2
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A2 Gene:POMT2. Exons: NM_013382.5:1- 21. Variants(5): c.1117G>T, c.2177G>A, c.1238G>C, c.1912C>T, c.1057G>A
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A3
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A3 Gene:POMGNT1. Exons: NM_017739.3:2-22. Variants(7): c.932G>A, c.1425G>A, c.1539+1G>A, c.1539+1G>T, c.187C>T, c.652+1G>A, c.1864delC
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A4
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A4 Gene:FKTN. Exons: NM_001079802.1:3-11. Variants(2): c.509C>A, c.1112A>G
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) type A6
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) type A6 Gene:LARGE. Exons: NM_004737.4:3- 16. Variants(2): c.1483T>C, c.992C>T
Muscular Dystrophy-Dystroglycanopathy (Congenital with Mental retardation) Type B1
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (Congenital with Mental retardation) Type B1 Gene:POMT1. Exons: NM_007171.3:2- 20. Variants(6): c.2163C>A, c.2005G>A, c.1540C>T, c.1746G>C, c.193G>A, c.1770G>C
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B2
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B2 Gene:POMT2. Exons: NM_013382.5:1- 21. Variants(4): c.1941G>A, c.1997A>G, c.2242T>C, c.1445G>T
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B3
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B3 Gene:POMGNT1. Exons: NM_017739.3:2- 22. Variants(2): c.1469G>A, c.1814G>C
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) type B6
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) type B6 Gene:LARGE. Exons: NM_004737.4:3- 16. Variants(1): c.1525G>A
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C1
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C1 Gene:POMT1. Exons: NM_007171.3:2-20. Variants(1): c.598G>C
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C2
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C2 Gene:POMT2. Exons: NM_013382.5:1-21. Variants(2): c.551C>T, c.2243G>C
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C4
Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C4 Gene:FKTN. Exons: NM_001079802.1:3-11. Variants(3): c.340G>A, c.527T>C, c.920G>A
MUT-Related Methylmalonic Acidemia
Condition Gene/Varient
MUT-Related Methylmalonic Acidemia Gene:MUT. Exons: NM_000255.3:2-13. Variants(10): c.2150G>T, c.2080C>T, c.313T>C, c.655A>T, c.1105C>T, c.278G>A, c.1867G>A, c.322C>T, c.643G>A, c.682C>T
Myopathy with Deficiency of ISCU. Gene:ISCU. Exons: NM_213595.2:2-5. Variants(1): c.149G>A Myotonia Congenita
Condition Gene/Varient
Myopathy with Deficiency of ISCU. Gene:ISCU. Exons: NM_213595.2:2-5. Variants(1): c.149G>A Myotonia Congenita Gene:CLCN1. Exons: NM_000083.2:1-23. Variants(5): c.501C>G, c.1238T>G, c.1453A>G, c.871G>A, c.2680C>T
N-acetylglutamate synthase deficiency
Condition Gene/Varient
N-acetylglutamate synthase deficiency Gene:NAGS. Exons: NM_153006.2:2-7. Variants(6): c.971G>A, c.916-2A>T, c.1025delG, c.1299G>C, c.1307dupT, c.1289T>C
Nanophthalmos 2
Condition Gene/Varient
Nanophthalmos 2 Gene:MFRP. Exons: NM_031433.2:1-13. Variants(4): c.1150_1151insC, c.545T>C, c.523C>T, c.498delC
Nemaline Myopathy 2
Condition Gene/Varient
Nemaline Myopathy 2 Gene:NEB. Exons: NM_004543.4:3-56,58-60,62-65,68-150. Variants(3): c.18318_18319delAG, c.19606G>T, c.19119_19120delGA
Nemaline Myopathy 5
Condition Gene/Varient
Nemaline Myopathy 5 Gene:TNNT1. Exons: NM_003283.4:2-3,5-14. Variants(1): c.538G>
T Nephronophthisis 1
Condition Gene/Varient
T Nephronophthisis 1 Gene:NPHP1. Exons: NM_000272.3:1-20. Variants(2): c.1884+1G>T, c.80T>
A Nephronophthisis 11
Condition Gene/Varient
A Nephronophthisis 11 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(4): c.2461G>A, c.1843T>C, c.869G>T, c.2461G>C
Nephronophthisis 2
Condition Gene/Varient
Nephronophthisis 2 Gene:INVS. Exons: NM_014425.3:2-17. Variants(5): c.1453delC, c.2695C>T, c.2719C>T, c.1478T>C, c.1807C>T
Nephropathic Cystinosis
Condition Gene/Varient
Nephropathic Cystinosis Gene:CTNS. Exons: NM_004937.2:3-12. Variants(10): c.969C>G, c.397_398delAT, c.357_360delCAGC, c.414G>A, c.853-3C>G, c.329G>T, c.1015G>A, c.416C>T, c.473T>C, c.283G>T
Nephrotic Syndrome Type 1
Condition Gene/Varient
Nephrotic Syndrome Type 1 Gene:NPHS1. Exons: NM_004646.3:1-29. Variants(10): c.1481delC, c.2456A>T, c.121_122delCT, c.1307_1308dupAC, c.3250_3251insG, c.2464G>A, c.3478C>T, c.3325C>T, c.3250delG, c.793T>C
Nephrotic Syndrome Type 2
Condition Gene/Varient
Nephrotic Syndrome Type 2 Gene:NPHS2. Exons: NM_014625.2:1-8. Variants(1): c.413G>A
Nephrotic Syndrome Type 3
Condition Gene/Varient
Nephrotic Syndrome Type 3 Gene:PLCE1. Exons: NM_016341.3:2-32. Variants(8): c.4846C>T, c.3736C>T, c.961C>T, c.3846delG, c.3346C>T, c.1477C>T, c.4451C>T, c.5560C>T
Neurodegeneration With Brain Iron Accumulation 2
Condition Gene/Varient
Neurodegeneration With Brain Iron Accumulation 2 Gene:PLA2G6. Exons: NM_003560.2:2-17. Variants(6): c.2370T>G, c.1894C>T, c.1634A>C, c.109C>T, c.929T>A, c.238G>
A Neuronal Ceroid-Lipofuscinoses 1
Condition Gene/Varient
A Neuronal Ceroid-Lipofuscinoses 1 Gene:PPT1. Exons: NM_000310.3:1-9. Variants(7): c.29T>A, c.223A>C, c.169_170insA, c.322G>C, c.236A>G, c.451C>T, c.364A>T
Neuronal Ceroid-Lipofuscinoses 10
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 10 Gene:CTSD. Exons: NM_001909.4:2-9. Variants(2): c.1149G>C, c.685T>A
Neuronal Ceroid-Lipofuscinoses 2
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 2 Gene:TPP1. Exons: NM_000391.3:1-13. Variants(8): c.1340G>A, c.616C>T, c.857A>G, c.509-1G>C, c.1094G>A, c.622C>T, c.1093T>C, c.851G>T
Neuronal Ceroid-Lipofuscinoses 3
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 3 Gene:CLN3. Exons: NM_001042432.1:2-16. Variants(2): c.597C>A, c.883G>A
Neuronal Ceroid-Lipofuscinoses 4A
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 4A Gene:CLN6. Exons: NM_017882.2:2-7. Variants(3): c.308G>A, c.139C>T, c.200T>C
Neuronal Ceroid-Lipofuscinoses 5
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 5 Gene:CLN5. Exons: NM_006493.2:1-4. Variants(2): c.1175_1176delAT, c.1054G>T
Neuronal Ceroid-Lipofuscinoses 6
I am text block. Click edit button to change this text. Lorem ipsum dolor Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 6 Gene:CLN6. Exons: NM_017882.2:2-7. Variants(3): c.316_317insC, c.214G>T, c.663C>G
Neuronal Ceroid-Lipofuscinoses 7
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 7 Gene:MFSD8. Exons: NM_152778.2:2-13. Variants(6): c.1235C>T, c.1286G>A, c.362A>G, c.894T>G, c.881C>A, c.929G>A
Neuronal Ceroid-Lipofuscinoses 8
Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 8 Gene:CLN8. Exons: NM_018941.3:2-3. Variants(5): c.611G>T, c.88G>C, c.789G>C, c.88delG, c.70C>G
Niemann-Pick Disease Type A
Condition Gene/Varient
Niemann-Pick Disease Type A Gene:SMPD1. Exons: NM_000543.4:1-6. Variants(5): c.1493G>T, c.996delC, c.1152G>A, c.911T>C, c.788T>A
Niemann-Pick Disease Type B
Condition Gene/Varient
Niemann-Pick Disease Type B Gene:SMPD1. Exons: NM_000543.4:1-6. Variants(3): c.1327C>T, c.1829_1831delGCC, c.1267C>T
Niemann-Pick Disease Type C1
Condition Gene/Varient
Niemann-Pick Disease Type C1 Gene:NPC1. Exons: NM_000271.4:2-25. Variants(16): c.3467A>G, c.3662delT, c.3263A>G, c.337T>C, c.2974G>A, c.2848G>A, c.3611_3614delTTAC, c.3107C>T, c.2873G>A, c.3104C>T, c.3175C>T, c.2932C>T, c.530G>A, c.2974G>T, c.3591+1G>A, c.3182T>C
Niemann-Pick Disease Type C2
Condition Gene/Varient
Niemann-Pick Disease Type C2 Gene:NPC2. Exons: NM_006432.3:1-5. Variants(11): c.441+1G>A, c.358C>T, c.27delG, c.111delG, c.199T>C, c.436C>T, c.82+2T>C, c.58G>T, c.352G>T, c.190+5G>A, c.115G>A
Night blindness, congenital stationary (complete) 1B, Autosomal Recessive
Condition Gene/Varient
Night blindness, congenital stationary (complete) 1B, Autosomal Recessive Gene:GRM6. Exons: NM_000843.3:2-10. Variants(7): c.2341G>A, c.719_720insG, c.727_728insG, c.2122C>T, c.1214T>C, c.1565G>A, c.1861C>T
Night blindness, congenital stationary (complete) 1E, Autosomal Recessive
Condition Gene/Varient
Night blindness, congenital stationary (complete) 1E, Autosomal Recessive Gene:GPR179. Exons: NM_001004334.2:1-11. Variants(6): c.278delC, c.187delC, c.598C>T, c.1784+1G>A, c.984delC, c.1807C>T
Night blindness, congenital stationary (complete)1A
Condition Gene/Varient
Night blindness, congenital stationary (complete)1A Gene:NYX. Exons: NM_022567.2:1. Variants(1): c.1049G>A Night blindness, congenital stationary (complete)1D. Gene:SLC24A1. Exons: NM_004727.2:2-10. Variants(1): c.1613_1614delTT
Nijmegen breakage syndrome
Condition Gene/Varient
Nijmegen breakage syndrome Gene:NBN. Exons: NM_002485.4:1-16. Variants(1): c.657_661delACAAA
Oculocutaneous Albinism Type 1
Condition Gene/Varient
Oculocutaneous Albinism Type 1 Gene:TYR. Exons: NM_000372.4:1-4. Variants(30): c.823G>T, c.1118C>A, c.265T>C, c.1012_1013insC, c.272G>A, c.1501dupC, c.896G>A, c.1A>G, c.230G>A, c.1164delT, c.572delG, c.707G>A, c.1209G>T, c.1265G>A, c.1336G>A, c.164G>A, c.140G>A, c.649C>T, c.1217C>T, c.1255G>A, c.1147G>A, c.616G>A, c.1146C>A, c.650G>A, c.1467dupT, c.242C>T, c.1342G>A, c.533G>A, c.732_733delTG, c.286dupA
Oculocutaneous Albinism Type 2
Condition Gene/Varient
Oculocutaneous Albinism Type 2 Gene:OCA2. Exons: NM_000275.2:2-24. Variants(8): c.79G>A, c.2037G>C, c.1465A>G, c.1960delG, c.1842+1G>T, c.1327G>A, c.2228C>T, c.1182G>A
Oculocutaneous Albinism Type 3
Condition Gene/Varient
Oculocutaneous Albinism Type 3 Gene:TYRP1. Exons: NM_000550.2:2-8. Variants(6): c.1120C>T, c.1103delA, c.107delT, c.497C>G, c.1057_1060delAACA, c.1067G>A
Oculocutaneous Albinism Type 4
Condition Gene/Varient
Oculocutaneous Albinism Type 4 Gene:SLC45A2. Exons: NM_016180.3:1-7. Variants(3): c.986delC, c.469G>A, c.1121delT
Odontoonychodermal Dysplasia
Condition Gene/Varient
Odontoonychodermal Dysplasia Gene:WNT10A. Exons: NM_025216.2:1-3. Variants(3): c.321C>A, c.697G>T, c.383G>A
Oguchi Disease-1
Condition Gene/Varient
Oguchi Disease-1 Gene:SAG. Exons: NM_000541.4:2-16. Variants(5): c.926delA, c.577C>T, c.523C>T, c.874C>T, c.916G>T
Ohdo Syndrome
Condition Gene/Varient
Ohdo Syndrome Gene:MED12. Exons: NM_005120.2:1-41,43-45. Variants(3): c.5185C>A, c.3443G>A, c.3493T>C
Ornithine Transcarbamylase Deficiency
Condition Gene/Varient
Ornithine Transcarbamylase Deficiency Gene:OTC. Exons: NM_000531.5:1-10. Variants(14): c.386G>A, c.77G>A, c.829C>T, c.617T>G, c.332T>C, c.119G>A, c.646C>G, c.717+2T>C, c.259G>A, c.118C>T, c.148G>T, c.674C>T, c.460G>T, c.134T>C
Osteogenesis Imperfecta Type VII
Condition Gene/Varient
Osteogenesis Imperfecta Type VII Gene:CRTAP. Exons: NM_006371.4:2-7. Variants(2): c.561T>G, c.826C>T
Osteogenesis Imperfecta Type VIII
Condition Gene/Varient
Osteogenesis Imperfecta Type VIII Gene:LEPRE1. Exons: NM_022356.3:1-15. Variants(6): c.747delC, c.1080+1G>T, c.1473+1G>T, c.1102C>T, c.1365_1366delAGinsC, c.1656C>A
Osteoporosis-Pseudoglioma Syndrome
Condition Gene/Varient
Osteoporosis-Pseudoglioma Syndrome Gene:LRP5. Exons: NM_002335.2:2-23. Variants(9): c.1282C>T, c.1481G>A, c.1468delG, c.2202G>A, c.1453G>T, c.2305delG, c.1708C>T, c.1584+1G>A, c.2557C>T
Pancreatic Agenesis
Condition Gene/Varient
Pancreatic Agenesis Gene:PDX1. Exons: NM_000209.3:1. Variants(3): c.492G>T, c.533A>G, c.532G>A
Pantothenate Kinase-Associated Neurodegeneration
Condition Gene/Varient
Pantothenate Kinase-Associated Neurodegeneration Gene:PANK2. Exons: NM_153638.2:1-7. Variants(5): c.790C>T, c.570C>G, c.1583C>T, c.1561G>A, c.533C>A
PCCA-Related Propionic Acidemia
Condition Gene/Varient
PCCA-Related Propionic Acidemia Gene:PCCA. Exons: NM_000282.3:1-24. Variants(3): c.1891G>C, c.412G>A, c.862A>T
PCCB-Related Propionic Acidemia
Condition Gene/Varient
PCCB-Related Propionic Acidemia Gene:PCCB. Exons: NM_000532.4:1-15. Variants(9): c.1283C>T, c.1173_1174insT, c.1228C>T, c.737G>T, c.1495C>T, c.502G>A, c.1534C>T, c.1304A>G, c.1540_1541insCCC
Pelizaeus-Merzbacher Disease
Condition Gene/Varient
Pelizaeus-Merzbacher Disease Gene:PLP1. Exons: NM_000533.3:1-7. Variants(3): c.169G>T, c.725C>T, c.3G>A
Peroxisomal acyl-CoA oxidase deficiency
Condition Gene/Varient
Peroxisomal acyl-CoA oxidase deficiency Gene:ACOX1. Exons: NM_004035.6:1-14. Variants(4): c.442C>T, c.832A>G, c.926A>G, c.532G>T
Peroxisome biogenesis disorder 1
Condition Gene/Varient
Peroxisome biogenesis disorder 1 Gene:PEX1. Exons: NM_000466.2:1-24. Variants(4): c.2097_2098insT, c.1991T>C, c.2916delA, c.2528G>A
Peroxisome biogenesis disorder 2
Condition Gene/Varient
Peroxisome biogenesis disorder 2 Gene:PEX5. Exons: NM_001131025.1:2-16. Variants(2): c.1279C>T, c.1578T>G
Peroxisome biogenesis disorder 3
Condition Gene/Varient
Peroxisome biogenesis disorder 3 Gene:PEX12. Exons: NM_000286.2:1-3. Variants(3): c.691A>T, c.538C>T, c.959C>T
Peroxisome biogenesis disorder 5
Condition Gene/Varient
Peroxisome biogenesis disorder 5 Gene:PEX2. Exons: NM_000318.2:4. Variants(2): c.163G>A, c.355C>T
Peroxisome biogenesis disorder 6
Condition Gene/Varient
Peroxisome biogenesis disorder 6 Gene:PEX10. Exons: NM_153818.1:2-6. Variants(2): c.704_705insA, c.373C>T
Peroxisome biogenesis disorder 7
Condition Gene/Varient
Peroxisome biogenesis disorder 7 Gene:PEX26. Exons: NM_017929.5:2-6. Variants(5): c.254dupT, c.265G>A, c.34_35insC, c.292C>T, c.2T>C
Phenylketonuria
Condition Gene/Varient
Phenylketonuria Gene:PAH. Exons: NM_000277.1:1-13. Variants(203): c.165T>G, c.208_210delTCT, c.464G>A, c.932T>C, c.727C>T, c.805A>C, c.1021A>T, c.618C>A, c.441+1G>A, c.168+1G>A, c.896T>G, c.353-1G>C, c.204A>T, c.1A>G, c.1056delT, c.694C>T, c.728G>A, c.754C>T, c.122T>C, c.581T>C, c.1157A>G, c.782G>A, c.662A>G, c.943G>T, c.678G>C, c.763T>G, c.977G>A, c.901C>T, c.559T>C, c.1089delG, c.721C>T, c.913-7A>G, c.775G>A, c.611A>G, c.997C>T, c.1200-8G>A, c.1084C>A, c.814G>T, c.1112A>G, c.1045T>C, c.975C>G, c.1232C>G, c.168+5G>A, c.558_559delAT, c.912+2T>C, c.818C>T, c.284_286delTCA, c.941C>A, c.1129delT, c.1055delG, c.608G>A, c.745C>T, c.442G>A, c.442-1G>A, c.841C>G, c.1197A>T, c.926C>A, c.136G>A, c.1161C>A, c.829T>G, c.183C>G, c.667A>T, c.691T>C, c.143T>C, c.1042C>G, c.1238G>C, c.737delC, c.1315+1G>A, c.911A>G, c.619A>G, c.1159T>C, c.842+5G>A, c.715G>A, c.491T>C, c.1315+6T>A, c.722delG, c.165delT, c.47_48delCT, c.1127delA, c.1172G>T, c.119C>T, c.439C>T, c.193A>G, c.671T>C, c.1196_1199delTAAG, c.1114A>T, c.521T>C, c.1220delC, c.1144T>C, c.482T>C, c.1315+2T>C, c.842+2T>A, c.398_401delATCA, c.355C>T, c.719T>C, c.838G>A, c.509+1G>A, c.58C>T, c.502T>C, c.806delT, c.826A>G, c.842+3G>C, c.740G>A, c.1289T>C, c.169-13T>G, c.1066-11G>A, c.241A>C, c.194T>A, c.968_970delCAA, c.442-2A>C, c.1200-1G>A, c.1315+4A>G, c.964G>A, c.960G>C, c.1200delG, c.111_112insC, c.503delA, c.1012G>T, c.776C>T, c.1199+1G>A, c.632delC, c.707-1G>A, c.789C>G, c.1180G>C, c.755G>A, c.692C>T, c.117C>G, c.884C>G, c.1199+2T>C, c.169-2A>G, c.199T>C, c.856G>A, c.529G>A, c.664_665delGA, c.953T>C, c.514C>T, c.970-2A>C, c.969+1G>A, c.724C>T, c.1183G>C, c.1006C>T, c.712A>C, c.441+3G>C, c.739G>A, c.259A>C, c.731C>T, c.847A>T, c.941delC, c.781C>T, c.1340C>A, c.580_581delCT, c.137delG, c.569T>C, c.635T>C, c.734T>A, c.1199G>A, c.733G>C, c.1033G>A, c.810A>T, c.473G>A, c.490A>G, c.208T>C, c.601C>T, c.916delA, c.665A>G, c.1229T>C, c.116_118delTCT, c.809G>A, c.648C>G, c.359G>A, c.264dupG, c.250G>T, c.1057delG, c.226G>T, c.842+1G>A, c.533A>G, c.907T>C, c.1301C>A, c.1222C>T, c.1024G>A, c.194T>C, c.441+5G>T, c.1024delG, c.508C>G, c.1065+1G>A, c.535T>C, c.1219C>T, c.1076C>G, c.331C>T, c.974A>G, c.889C>T, c.673C>A, c.311C>A, c.912+1G>A, c.1066-1G>A, c.764T>C, c.638T>C, c.890G>A, c.1220C>T, c.1068C>A, c.472C>T, c.1200-2A>G, c.842C>T
Phosphoribosylpyrophosphate Synthetase Superactivity
Condition Gene/Varient
Phosphoribosylpyrophosphate Synthetase Superactivity Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(2): c.398A>C, c.455T>C
Phosphoserine Aminotransferase Deficiency
Condition Gene/Varient
Phosphoserine Aminotransferase Deficiency Gene:PSAT1. Exons: NM_058179.2:1-9. Variants(1): c.299A>C
POLG-Related Disorders
Condition Gene/Varient
POLG-Related Disorders Gene:POLG. Exons: NM_002693.2:2-23. Variants(18): c.695G>A, c.2591A>G, c.1879C>T, c.3218C>T, c.911T>G, c.2209G>C, c.679C>T, c.1399G>A, c.2557C>T, c.3630dupC, c.2243G>C, c.8G>C, c.752C>T, c.1491G>C, c.2794C>T, c.2T>C, c.2542G>A, c.2617G>T
Pontocerebellar Hypoplasia
Condition Gene/Varient
Pontocerebellar Hypoplasia Gene:TSEN54. Exons: NM_207346.2:3-11. Variants(3): c.919G>T, c.736C>T, c.1027C>T
Primary Autosomal Recessive Microcephaly 1
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 1 Gene:MCPH1. Exons: NM_024596.3:1-14. Variants(5): c.74C>G, c.566_567insA, c.215C>T, c.302C>G, c.427_428insA
Primary Autosomal Recessive Microcephaly 2
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 2 Gene:WDR62. Exons: NM_001083961.1:1-32. Variants(5): c.1313G>A, c.1531G>A, c.671G>C, c.193G>A, c.1408C>T
Primary Autosomal Recessive Microcephaly 3
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 3 Gene:CDK5RAP2. Exons: NM_018249.4:1-38. Variants(6): c.4441C>T, c.4672C>T, c.246T>A, c.524_528delAGGCA, c.700G>T, c.4546G>
T Primary Autosomal Recessive Microcephaly 5
Condition Gene/Varient
T Primary Autosomal Recessive Microcephaly 5 Gene:ASPM. Exons: NM_018136.4:1-28. Variants(64): c.4795C>T, c.9677dupG, c.2389C>T, c.7491_7495delTATTA, c.3527C>G, c.1729_1730delAG, c.3477_3481delCGCTA, c.9697C>T, c.3188T>G, c.6189T>G, c.9730C>T, c.1590delA, c.6337_6338delAT, c.1366G>T, c.5136C>A, c.1406_1413delATCCTAAA, c.8844delC, c.7894C>T, c.7761T>G, c.9178C>T, c.3796G>T, c.9595A>T, c.719_720delCT, c.1002delA, c.9238A>T, c.577C>T, c.9539A>C, c.3811C>T, c.9190C>T, c.7782_7783delGA, c.5149delA, c.9557C>G, c.440delA, c.8131_8132delAA, c.10059C>A, c.8668C>T, c.9747_9748delCT, c.1260_1266delTCAAGTC, c.1179delT, c.3055C>T, c.3082G>A, c.9789T>A, c.1990C>T, c.2938C>T, c.3663delG, c.2967G>A, c.9492T>G, c.4858_4859delAT, c.9159delA, c.9319C>T, c.8378delT, c.3710C>G, c.8508_8509delGA, c.4195dupA, c.9115_9118dupCATT, c.1154_1155delAG, c.6732delA, c.9685delA, c.7860_7861delGA, c.3978G>A, c.349C>T, c.1959_1962delCAAA, c.9754delA, c.4583delA
Primary Autosomal Recessive Microcephaly 6
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 6 Gene:CENPJ. Exons: NM_018451.4:2-17. Variants(3): c.3704A>T, c.3243_3246delTCAG, c.18delC
Primary Autosomal Recessive Microcephaly 7
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 7 Gene:STIL. Exons: NM_003035.2:2-17. Variants(4): c.2826+1G>A, c.3715C>T, c.2392T>G, c.3655delG
Primary Autosomal Recessive Microcephaly 9
Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 9 Gene:CEP152. Exons: NM_014985.3:2-26. Variants(1): c.794A>C
Primary Coenzyme Q10 deficiency 1
Condition Gene/Varient
Primary Coenzyme Q10 deficiency 1 Gene:COQ2. Exons: NM_015697.7:2-7. Variants(3): c.890A>G, c.683A>G, c.590G>A
Primary Coenzyme Q10 deficiency 2
Condition Gene/Varient
Primary Coenzyme Q10 deficiency 2 Gene:PDSS1. Exons: NM_014317.3:312. Variants(1): c.924T>G
Primary Coenzyme Q10 deficiency 3
Condition Gene/Varient
Primary Coenzyme Q10 deficiency 3 Gene:PDSS2. Exons: NM_020381.3:1-8. Variants(2): c.964C>T, c.1145C>T
Primary Coenzyme Q10 deficiency 4
Condition Gene/Varient
Primary Coenzyme Q10 deficiency 4 Gene:ADCK3. Exons: NM_020247.4:2-15. Variants(7): c.1645G>A, c.1541A>G, c.637C>T, c.1813_1814insG, c.815G>T, c.1651G>A, c.815G>A
Primary Hyperoxaluria Type I
Condition Gene/Varient
Primary Hyperoxaluria Type I Gene:AGXT. Exons: NM_000030.2:1-11. Variants(12): c.454T>A, c.322T>C, c.466G>A, c.731T>C, c.613T>C, c.560C>T, c.697C>T, c.121G>A, c.508G>A, c.738G>A, c.33_34insC, c.245G>A
Primary Hyperoxaluria Type II
Condition Gene/Varient
Primary Hyperoxaluria Type II Gene:GRHPR. Exons: NM_012203.1:1-9. Variants(3): c.103delG, c.295C>T, c.403_404+2delAAGT
Progressive Myoclonic Epilepsy 1A
Condition Gene/Varient
Progressive Myoclonic Epilepsy 1A Gene:CSTB. Exons: NM_000100.3:1-3. Variants(2): c.212A>C, c.202C>T
Pycnodysostosis
Condition Gene/Varient
Pycnodysostosis Gene:CTSK. Exons: NM_000396.3:2-8. Variants(5): c.721C>T, c.154A>T, c.236G>A, c.990A>G, c.926T>C
Pyridoxal 5'-Phosphate-dependent Epilepsy
Condition Gene/Varient
Pyridoxal 5′-Phosphate-dependent Epilepsy Gene:PNPO. Exons: NM_018129.3:1-7. Variants(2): c.685C>T, c.784T>C
Pyruvate Carboxylase Deficiency
Condition Gene/Varient
Pyruvate Carboxylase Deficiency Gene:PC. Exons: NM_000920.3:3-22. Variants(4): c.467G>A, c.1748G>T, c.434T>C, c.1828G>A
Pyruvate Dehydrogenase Phosphatase Deficiency
Condition Gene/Varient
Pyruvate Dehydrogenase Phosphatase Deficiency Gene:PDP1. Exons: NM_018444.3:2. Variants(2): c.851_853delTTC, c.277G>T
Pyruvate Kinase Deficiency
Condition Gene/Varient
Pyruvate Kinase Deficiency Gene:PKLR. Exons: NM_000298.5:1-11. Variants(8): c.110G>A, c.1261C>A, c.1675C>T, c.1529G>A, c.1151C>T, c.1436G>A, c.487C>T, c.1456C>T
Rabson-Mendenhall Syndrome
Condition Gene/Varient
Rabson-Mendenhall Syndrome Gene:INSR. Exons: NM_000208.2:2-22. Variants(1): c.3079C>T
RAG1-Related Omenn Syndrome
Condition Gene/Varient
RAG1-Related Omenn Syndrome Gene:RAG1. Exons: NM_000448.2:2. Variants(3): c.1682G>A, c.1681C>T, c.983G>A
RAG1-Related Severe Combined Immunodeficiency
Condition Gene/Varient
RAG1-Related Severe Combined Immunodeficiency Gene:RAG1. Exons: NM_000448.2:2. Variants(7): c.2320G>T, c.2164G>A, c.2326C>T, c.940C>T, c.2923C>T, c.2333G>A, c.2814T>G
RAG2-Related Severe Combined Immunodeficiency
Condition Gene/Varient
RAG2-Related Severe Combined Immunodeficiency Gene:RAG2. Exons: NM_000536.3:2. Variants(4): c.115A>G, c.1352G>C, c.230C>A, c.686G>A
Raine Syndrome
Condition Gene/Varient
Raine Syndrome Gene:FAM20C. Exons: NM_020223.3:2-10. Variants(6): c.1351G>A, c.1163T>G, c.1093G>C, c.1645C>T, c.838G>A, c.773T>A
RAPSN-Related Congenital Myasthenic Syndrome
Condition Gene/Varient
RAPSN-Related Congenital Myasthenic Syndrome Gene:RAPSN. Exons: NM_005055.4:1-8. Variants(5): c.264C>A, c.807C>A, c.490C>T, c.848T>C, c.484G>A
Refsum Disease
Condition Gene/Varient
Refsum Disease Gene:PHYH. Exons: NM_006214.3:2-9. Variants(13): c.497-2A>G, c.805A>C, c.678+5G>T, c.734G>A, c.135-2A>G, c.164delT, c.679-1G>T, c.823C>T, c.135-1G>C, c.824G>A, c.610G>A, c.530A>G, c.678+2T>G
Renal-Hepatic-Pancreatic Dysplasia
Condition Gene/Varient
Refsum Disease Gene:NPHP3. Exons: NM_153240.4:1-27. Variants(3): c.3340C>T, c.1985+5G>A, c.1729C>T
REN-Related Renal Tubular Dysgenesis
Condition Gene/Varient
REN-Related Renal Tubular Dysgenesis Gene:REN. Exons: NM_000537.3:1-10. Variants(4): c.689G>A, c.404C>A, c.127C>T, c.145C>T
Restrictive Dermopathy, Lethal
Condition Gene/Varient
Restrictive Dermopathy, Lethal Gene:ZMPSTE24. Exons: NM_005857.4:1-10. Variants(3): c.1085_1086insT, c.715G>T, c.54dupT
Retinal cone dystrophy 3B
Condition Gene/Varient
Retinal cone dystrophy 3B Gene:KCNV2. Exons: NM_133497.3:1-2. Variants(10): c.1016_1024delACCTGGTGG, c.8_11delAACA, c.916G>T, c.357_358insC, c.491T>C, c.767C>G, c.226C>T, c.1376G>A, c.427G>T, c.325C>T
Retinitis Pigmentosa 12
Condition Gene/Varient
Retinitis Pigmentosa 12 Gene:CRB1. Exons: NM_201253.2:1-12. Variants(6): c.2290C>T, c.2983G>T, c.3299T>C, c.3541T>C, c.2401A>T, c.3122T>C
Retinitis Pigmentosa 14
Condition Gene/Varient
Retinitis Pigmentosa 14 Gene:TULP1. Exons: NM_003322.3:1-15. Variants(6): c.1259G>C, c.1471T>C, c.1511_1521delTGCAGTTCGGC, c.99+1G>A, c.1376T>A, c.1444C>T
Retinitis Pigmentosa 19
Condition Gene/Varient
Retinitis Pigmentosa 19 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(3): c.1938-1G>A, c.1848delA, c.4539+1G>T
Retinitis Pigmentosa 2
Condition Gene/Varient
Retinitis Pigmentosa 2 Gene:RP2. Exons: NM_006915.2:1-5. Variants(7): c.358C>T, c.453delC, c.353G>T, c.305_306insT, c.353G>A, c.76C>T, c.453C>G
Retinitis Pigmentosa 20
Condition Gene/Varient
Retinitis Pigmentosa 20 Gene:RPE65. Exons: NM_000329.2:1-14. Variants(7): c.1543C>T, c.1087C>A, c.1355T>G, c.271C>T, c.394G>A, c.1102T>C, c.1022T>C
Retinitis Pigmentosa 25
Condition Gene/Varient
Retinitis Pigmentosa 25 Gene:EYS. Exons: NM_001142800.1:4-43. Variants(3): c.5928-2A>G, c.6714delT, c.5857G>T
Retinitis Pigmentosa 26
Condition Gene/Varient
Retinitis Pigmentosa 26 Gene:CERKL. Exons: NM_201548.4:1-13. Variants(4): c.420delT, c.598A>T, c.769C>T, c.780delT
Retinitis Pigmentosa 3
Condition Gene/Varient
Retinitis Pigmentosa 3 Gene:RPGR. Exons: NM_001034853.1:2-15. Variants(11): c.674_675delCC, c.179G>T, c.654_655delGA, c.823G>A, c.296C>A, c.389T>G, c.517G>C, c.173_174insA, c.846_847delAA, c.1433_1436delTGAC, c.703C>T
Retinitis Pigmentosa 35
Condition Gene/Varient
Retinitis Pigmentosa 35 Gene:SEMA4A. Exons: NM_022367.3:2-15. Variants(2): c.1033G>C, c.1049T>G
Retinitis Pigmentosa 36
Condition Gene/Varient
Retinitis Pigmentosa 36 Gene:PRCD. Exons: NM_001077620.2:1-3. Variants(2): c.5G>A, c.64C>T
Retinitis Pigmentosa 37
Condition Gene/Varient
Retinitis Pigmentosa 37 Gene:NR2E3. Exons: NM_014249.2:1-8. Variants(1): c.1034_1038delTGCAG
Retinitis Pigmentosa 38
Condition Gene/Varient
Retinitis Pigmentosa 38 Gene:MERTK. Exons: NM_006343.2:1-19. Variants(6): c.2323C>T, c.61+1G>A, c.2070_2074delAGGAC, c.2189+1G>T, c.1951C>T, c.1605-2A>G
Retinitis Pigmentosa 4
Condition Gene/Varient
Retinitis Pigmentosa 4 Gene:RHO. Exons: NM_000539.3:1-5. Variants(2): c.448G>A, c.745G>T
Retinitis Pigmentosa 40
Condition Gene/Varient
Retinitis Pigmentosa 40 Gene:PDE6B. Exons: NM_000283.3:1-22. Variants(4): c.1669C>T, c.1580T>C, c.1591C>T, c.892C>T
Retinitis Pigmentosa 41
Condition Gene/Varient
Retinitis Pigmentosa 41 Gene:PROM1. Exons: NM_006017.2:1-26. Variants(2): c.1726C>T, c.1841delG
Retinitis Pigmentosa 43
Condition Gene/Varient
Retinitis Pigmentosa 43 Gene:PDE6A. Exons: NM_000440.2:1-22. Variants(4): c.1683G>A, c.2053G>A, c.304C>A, c.1749C>G
Retinitis Pigmentosa 44
Condition Gene/Varient
Retinitis Pigmentosa 44 Gene:RGR. Exons: NM_001012720.1:1-7. Variants(1): c.196A>C Retinitis
Pigmentosa 45
Condition Gene/Varient
Pigmentosa 45 Gene:CNGB1. Exons: NM_001297.4:2-33. Variants(2): c.2978G>T, c.3462+1G>A
Retinitis Pigmentosa 46
Condition Gene/Varient
Pigmentosa 45 Gene:IDH3B. Exons: NM_006899.3:1-12. Variants(2): c.589delA, c.395T>C
Retinitis Pigmentosa 49
Condition Gene/Varient
Retinitis Pigmentosa 49 Gene:CNGA1. Exons: NM_000087.3:4-11. Variants(3): c.427A>T, c.959C>T, c.1972delA
Retinitis Pigmentosa 50
Condition Gene/Varient
Retinitis Pigmentosa 50 Gene:BEST1. Exons: NM_004183.3:2-11. Variants(1): c.418C>
G Retinitis Pigmentosa 56
Condition Gene/Varient
G Retinitis Pigmentosa 56 Gene:IMPG2. Exons: NM_016247.3:1-19. Variants(3): c.2716C>T, c.635C>G, c.2890C>T
Retinitis Pigmentosa 57
Condition Gene/Varient
Retinitis Pigmentosa 57 Gene:PDE6G. Exons: NM_002602.3:2-4. Variants(1): c.187+1G
T Retinitis Pigmentosa 59
Condition Gene/Varient
T Retinitis Pigmentosa 59 Gene:DHDDS. Exons: NM_024887.3:2-9. Variants(1): c.124A>G
Retinitis Pigmentosa 61
Condition Gene/Varient
Retinitis Pigmentosa 61 Gene:CLRN1. Exons: NM_174878.2:1-3. Variants(2): c.92C>T, c.461T>G
Retinitis Pigmentosa 62
Condition Gene/Varient
Retinitis Pigmentosa 62 Gene:MAK. Exons: NM_001242957.1:2-15. Variants(4): c.497G>A, c.388A>C, c.718C>T, c.37G>A
Retinitis Pigmentosa 65
Condition Gene/Varient
Retinitis Pigmentosa 65 Gene:CDHR1. Exons: NM_033100.2:2-17. Variants(3): c.1463delG, c.338delG, c.524dupA
Rhizomelic Chondrodysplasia Punctata Type 1
Condition Gene/Varient
Rhizomelic Chondrodysplasia Punctata Type 1 Gene:PEX7. Exons: NM_000288.3:2-10. Variants(7): c.903+1G>C, c.649G>A, c.618G>A, c.875T>A, c.653C>T, c.854A>G, c.694C>T
Rhizomelic Chondrodysplasia Punctata Type 3
Condition Gene/Varient
Rhizomelic Chondrodysplasia Punctata Type 3 Gene:AGPS. Exons: NM_003659.3:1-20. Variants(2): c.1703C>T, c.926C>T
Roberts Syndrome
Condition Gene/Varient
Roberts Syndrome Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(10): c.876_879delCAGA, c.1597dupT, c.751dupG, c.1111_1112insG, c.308_309delAA, c.764_765delTT, c.745_746delGT, c.879_880delAG, c.1615T>G, c.505C>T
RYR1 -Related Congenital Fiber-Type Disproportion
Condition Gene/Varient
RYR1 -Related Congenital Fiber-Type Disproportion Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(10): c.876_879delCAGA, c.1597dupT, c.751dupG, c.1111_1112insG, c.308_309delAA, c.764_765delTT, c.745_746delGT, c.879_880delAG, c.1615T>G, c.505C>T
Salla Disease
Condition Gene/Varient
Salla Disease Gene:SLC17A5. Exons: NM_012434.4:1-11. Variants(2): c.406A>G, c.115C>T
Sandhoff Disease
Condition Gene/Varient
Sandhoff Disease Gene:HEXB. Exons: NM_000521.3:1-14. Variants(4): c.1367A>C, c.1250C>T, c.965delT, c.850C>T
SC Phocomelia Syndrome
Condition Gene/Varient
SC Phocomelia Syndrome Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(4): c.604C>T, c.760_761insA, c.760delA, c.1269G>A
Schindler Disease
Condition Gene/Varient
Schindler Disease Gene:NAGA. Exons: NM_000262.2:1-9. Variants(1): c.973G>A
Schinzel phocomelia syndrome
Condition Gene/Varient
Schinzel phocomelia syndrome Gene:WNT7A. Exons: NM_004625.3:1-4. Variants(2): c.610G>A, c.874C>T
Schneckenbecken Dysplasia
Condition Gene/Varient
Schneckenbecken Dysplasia Gene:SLC35D1. Exons: NM_015139.2:1-12. Variants(3): c.932G>A, c.193A>C, c.319C>T
Schwartz-Jampel Syndrome Type 1
Condition Gene/Varient
Schwartz-Jampel Syndrome Type 1 Gene:HSPG2. Exons: NM_005529.5:2-97. Variants(2): c.4595G>A, c.8464+4A>G
SCNN1A-Related Autosomal Recessive Pseudohypoaldosteronism type 1
Condition Gene/Varient
SCNN1A-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1A. Exons: NM_001038.5:2-13. Variants(1): c.1522C>T
SCNN1B-Related Autosomal Recessive Pseudohypoaldosteronism type 1
Condition Gene/Varient
SCNN1B-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1B. Exons: NM_000336.2:2-13. Variants(1): c.109G>A
SCNN1G-Related Autosomal Recessive Pseudohypoaldosteronism type 1
Condition Gene/Varient
SCNN1G-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1G. Exons: NM_001039.3:2-13. Variants(2): c.1627delG, c.1570-1G>A
Seckel Syndrome 1
Condition Gene/Varient
Seckel Syndrome 1 Gene:ATR. Exons: NM_001184.3:1-47. Variants(1): c.5635G>T
Seckel syndrome 5
Condition Gene/Varient
Seckel syndrome 5 Gene:CEP152. Exons: NM_014985.3:2-26. Variants(1): c.2034T>G
Senior-Loken Syndrome 4
Condition Gene/Varient
Senior-Loken Syndrome 4 Gene:NPHP4. Exons: NM_015102.3:2-30. Variants(2): c.2335C>T, c.1972C>T
Senior-Loken Syndrome 5
Condition Gene/Varient
Senior-Loken Syndrome 5 Gene:IQCB1. Exons: NM_001023570.2:3-15. Variants(4): c.1465C>T, c.1069C>T, c.1036G>T, c.1381C>T
SEPN1-related Congenital Muscular Dystrophy
Condition Gene/Varient
SEPN1-related Congenital Muscular Dystrophy Gene:SEPN1. Exons: NM_020451.2:2,4-13. Variants(6): c.1385G>A, c.1358G>C, c.1384T>G, c.943G>A, c.1397G>A, c.818G>A
Septo-Optic Dysplasia
Condition Gene/Varient
Septo-Optic Dysplasia Gene:HESX1. Exons: NM_003865.2:1-4. Variants(4): c.357+2T>C, c.478C>T, c.450_451delCA, c.77T>C
Severe combined immunodeficiency, Athabascan type
Condition Gene/Varient
Severe combined immunodeficiency, Athabascan type Gene:DCLRE1C. Exons: NM_001033855.1:1-7,9-14. Variants(5): c.362+1G>T, c.597C>A, c.972+1G>C, c.917+1G>A, c.780+1delG
Severe Combined Immunodeficiency,T-negative/B-positive type
Condition Gene/Varient
Severe Combined Immunodeficiency,T-negative/B-positive type Gene:JAK3. Exons: NM_000215.3:2-24. Variants(4): c.299A>G, c.1695C>A, c.1333C>T, c.1172_1173insG
Short-Rib Thoracic Dysplasia 2
Condition Gene/Varient
Short-Rib Thoracic Dysplasia 2 Gene:IFT80. Exons: NM_020800.2:2-20. Variants(3): c.2101G>C, c.1646_1648delTAT, c.315C>G
Short-Rib Thoracic Dysplasia 3
Condition Gene/Varient
Short-Rib Thoracic Dysplasia 3 Gene:DYNC2H1. Exons: NM_001080463.1:1-90. Variants(10): c.5959A>G, c.10063G>T, c.5971A>T, c.8512C>T, c.9044A>G, c.4610A>G, c.3719T>C, c.6614G>A, c.1759C>T, c.7382G>T
Shwachman-Diamond Syndrome
Condition Gene/Varient
Shwachman-Diamond Syndrome Gene:SBDS. Exons: NM_016038.2:1,3,5. Variants(7): c.377G>C, c.652C>T, c.258+2T>C, c.258+1G>C, c.183_184delTAinsCT, c.120delG, c.505C>T
Sickle Cell Anemia
Condition Gene/Varient
Sickle Cell Anemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(5): c.19G>A, c.20A>T, c.79G>A, c.364G>A, c.364G>C
Simpson-Golabi-Behmel Syndrome Type 2
Condition Gene/Varient
Simpson-Golabi-Behmel Syndrome Type 2 Gene:OFD1. Exons: NM_003611.2:1-23. Variants(1): c.2126_2129dupAAAG
Sjogren-Larsson syndrome
Condition Gene/Varient
Sjogren-Larsson syndrome Gene:ALDH3A2. Exons: NM_000382.2:1-10. Variants(7): c.1157A>G, c.641G>A, c.521delT, c.809delG, c.943C>T, c.1297_1298delGA, c.1307_1311dupACAAA
SLC6A8-Related Creatine Transporter Deficiency
Condition Gene/Varient
SLC6A8-Related Creatine Transporter Deficiency Gene:SLC6A8. Exons: NM_005629.3:2,5-13. Variants(9): c.1631C>T, c.1011C>G, c.1540C>T, c.395G>T, c.1473C>G, c.1222_1224delTTC, c.1141G>C, c.321_323delCTT, c.1661C>T
Smith-Lemli-Opitz syndrome
Condition Gene/Varient
Smith-Lemli-Opitz syndrome Gene:DHCR7. Exons: NM_001360.2:3-9. Variants(19): c.356A>T, c.724C>T, c.976G>T, c.907G>A, c.1210C>T, c.278C>T, c.744G>T, c.964-1G>C, c.1054C>T, c.453G>A, c.1337G>A, c.1055G>A, c.904T>C, c.725G>A, c.506C>T, c.730G>A, c.832-1G>C, c.1228G>A, c.1342G>A
Spastic paraplegia 5A, autosomal recessive
Condition Gene/Varient
Spastic paraplegia 5A, autosomal recessive Gene:CYP7B1. Exons: NM_004820.3:2-6. Variants(2): c.825T>A, c.187C>T
Spinal Muscular Atrophy
Condition Gene/Varient
Spinal Muscular Atrophy Gene:SMN1. variants(1): EX7 del
Spondylocostal dysostosis 1
Condition Gene/Varient
Spondylocostal dysostosis 1 Gene:DLL3. Exons: NM_016941.3:1-3,5-6,8. Variants(2): c.1511G>A, c.712C>T
Spondyloepimetaphyseal Dysplasia
Condition Gene/Varient
Spondyloepimetaphyseal Dysplasia Gene:MATN3. Exons: NM_002381.4:2-8. Variants(1): c.910T>A
Stickler Syndrome Type IV
Condition Gene/Varient
Stickler Syndrome Type IV Gene:COL9A1. Exons: NM_001851.4:1-38. Variants(1): c.883C>T
Stuve-Wiedemann Syndrome
Condition Gene/Varient
Stuve-Wiedemann Syndrome Gene:LIFR. Exons: NM_002310.5:2-20. Variants(4): c.2013_2014insT, c.653dupT, c.1789C>T, c.171174delTAAC
Succinic Semialdehyde Dehydrogenase Deficiency
Condition Gene/Varient
Succinic Semialdehyde Dehydrogenase Deficiency Gene:ALDH5A1. Exons: NM_001080.3:2-10. Variants(3): c.1234C>T, c.612G>A, c.1226G>A
Sulfite Oxidase Deficiency
Condition Gene/Varient
Sulfite Oxidase Deficiency Gene:SUOX. Exons: NM_000456.2:4-6. Variants(2): c.794C>A, c.650G>A
Tay-Sachs Disease
Condition Gene/Varient
Tay-Sachs Disease Gene:HEXA. Exons: NM_000520.4:1-14. Variants(30): c.409C>T, c.1073+1G>A, c.1260G>C, c.1453T>C, c.116T>G, c.672+1G>A, c.1444G>A, c.1511G>A, c.915_917delCTT, c.1510delC, c.509G>A, c.540C>G, c.1177C>T, c.508C>T, c.1274_1277dupTATC, c.772G>C, c.78G>A, c.1510C>T, c.987G>A, c.805+1G>A, c.532C>T, c.1495C>T, c.1421+1G>C, c.1496G>A, c.533G>T, c.749G>A, c.1176G>A, c.533G>A, c.805G>A, c.1A>G
T-cell immunodeficiency, Congenital alopecia, and Nail dystrophy
Condition Gene/Varient
T-cell immunodeficiency, Congenital alopecia, and Nail dystrophy Gene:FOXN1. Exons: NM_003593.2:1-8. Variants(1): c.763C>T
Tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (HPA)
Condition Gene/Varient
Tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (HPA) Gene:PTS. Exons: NM_000317.2:1-6. Variants(1): c.286G>A
TMEM67-Related COACH Syndrome
Condition Gene/Varient
TMEM67-Related COACH Syndrome Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(2): c.2498T>C, c.1769T>C
Tyrosinemia Type I
Condition Gene/Varient
Tyrosinemia Type I Gene:FAH. Exons: NM_000137.2:1-14. Variants(13): c.1090G>T, c.47A>T, c.554-1G>T, c.1069G>T, c.786G>A, c.836A>G, c.1141A>G, c.782C>T, c.103G>A, c.1062+5G>A, c.1027G>T, c.698A>T, c.1009G>A
Tyrosinemia Type II
Condition Gene/Varient
Tyrosinemia Type II Gene:TAT. Exons: NM_000353.2:2-12. Variants(5): c.169C>T, c.1085G>T, c.668C>G, c.236-5A>G, c.1249C>T
Tyrosinemia Type III
Condition Gene/Varient
Tyrosinemia Type III Gene:HPD. Exons: NM_002150.2:1-14. Variants(3): c.1005C>G, c.774T>G, c.600C>G
Usher Syndrome Type 1B
Condition Gene/Varient
Usher Syndrome Type 1B Gene:MYO7A. Exons: NM_000260.3:2-49. Variants(8): c.635G>A, c.448C>T, c.1884C>A, c.5227C>T, c.6025delG, c.634C>T, c.1996C>T, c.3504-1G>C
Usher Syndrome Type 1C
Condition Gene/Varient
Usher Syndrome Type 1C Gene:USH1C. Exons: NM_153676.3:1-27. Variants(1): c.238_239insC
Usher Syndrome Type 1D
Condition Gene/Varient
Usher Syndrome Type 1D Gene:CDH23. Exons: NM_022124.5:2-70. Variants(8): c.7823G>A, c.193delC, c.6050-9G>A, c.4504C>T, c.288+1G>A, c.9565C>T, c.4488G>C, c.7224+5G>A
Usher Syndrome Type 1F
Condition Gene/Varient
Usher Syndrome Type 1F Gene:PCDH15. Exons: NM_033056.3:2-33. Variants(5): c.3718-2A>G, c.733C>T, c.7C>T, c.1940C>G, c.1088delT
Usher Syndrome Type 1G
Condition Gene/Varient
Usher Syndrome Type 1G Gene:USH1G. Exons: NM_173477.2:1-3. Variants(5): c.113G>A, c.143T>C, c.394_395insG, c.832_851delTCGGACGAGGACAGCGTCTC, c.186_187delCA
Usher Syndrome Type 2A
Condition Gene/Varient
Usher Syndrome Type 2A Gene:USH2A. Exons: NM_206933.2:2-72. Variants(15): c.14803C>T, c.5975A>G, c.9799T>C, c.2209C>T, c.779T>G, c.2898delG, c.4338_4339delCT, c.12574C>T, c.9424G>T, c.2299delG, c.2276G>T, c.920_923dupGCCA, c.11864G>A, c.8981G>A, c.956G>A
Usher Syndrome Type 2C
Condition Gene/Varient
Usher Syndrome Type 2C Gene:GPR98. Exons: NM_032119.3:1-90. Variants(8): c.17668_17669delAT, c.18131A>G, c.8790delC, c.8713_8716dupAACA, c.2258_2270delAAGTGCTGAAATC, c.5357_5358delAA, c.17137delG, c.6901C>T
Usher Syndrome Type 3A
Condition Gene/Varient
Usher Syndrome Type 3A Gene:CLRN1. Exons: NM_174878.2:1-3. Variants(7): c.449T>C, c.118T>G, c.144T>G, c.528T>G, c.459_461delATT, c.189C>A, c.359T>A
Vitamin D-resistant Rickets Type IIA
Condition Gene/Varient
Vitamin D-resistant Rickets Type IIA Gene:VDR. Exons: NM_001017535.1:4-11. Variants(7): c.915C>G, c.137G>A, c.1036G>A, c.88C>T, c.454C>T, c.239G>A, c.885C>A
VLDLR-Associated Cerebellar Hypoplasia
Condition Gene/Varient
VLDLR-Associated Cerebellar Hypoplasia Gene:VLDLR. Exons: NM_003383.3:2-19. Variants(3): c.1342C>T, c.2339delT, c.769C>T
Waardenburg Syndrome Type 3
Condition Gene/Varient
Waardenburg Syndrome Type 3 Gene:PAX3. Exons: NM_181457.3:1-8. Variants(2): c.251C>T, c.268T>C
Waardenburg Syndrome Type 4A
Condition Gene/Varient
Waardenburg Syndrome Type 4A Gene:EDNRB. Exons: NM_000115.3:2-8. Variants(2): c.548C>G, c.828G>T
Waardenburg Syndrome Type 4B
Condition Gene/Varient
Waardenburg Syndrome Type 4B Gene:EDN3. Exons: NM_207034.1:2-5. Variants(1): c.262_263delGCinsT
Warburg Micro Syndrome 1
Condition Gene/Varient
Warburg Micro Syndrome 1 Gene:RAB3GAP1. Exons: NM_012233.2:1-24. Variants(5): c.1410C>A, c.2011C>T, c.1734G>A, c.748+1G>A, c.899+1G>A
Wilson Disease
Condition Gene/Varient
Wilson Disease Gene:ATP7B. Exons: NM_000053.3:1-21. Variants(174): c.1772G>A, c.2131G>A, c.1369C>T, c.3646G>A, c.3359T>A, c.3903+1delG, c.2304_2305insG, c.3665A>T, c.2887C>T, c.1847G>A, c.3451C>T, c.1646T>C, c.2230T>C, c.2279C>T, c.3877G>A, c.2930C>T, c.2865+1G>A, c.3140delA, c.2828G>A, c.3818C>A, c.3505A>G, c.2827G>A, c.2009_2015delATATGCT, c.3713_3714delAA, c.314C>A, c.3436G>A, c.2662A>C, c.2293G>A, c.1639delC, c.3506T>C, c.1947-2A>G, c.3955C>T, c.397delT, c.2810delT, c.3402delC, c.4022-2A>G, c.1745_1746delTA, c.2122-8T>G, c.3412+1G>A, c.3091A>G, c.3244G>T, c.2463delC, c.2731-2A>G, c.3556G>A, c.3207C>A, c.2605G>A, c.2604delC, c.3659C>T, c.1924G>C, c.3182G>A, c.3699+1G>C, c.2519C>T, c.2335T>G, c.2297C>G, c.1708- 5T>G, c.122A>G, c.2975C>A, c.2513delA, c.1958C>A, c.3517G>A, c.3895C>T, c.3061-12T>A, c.3147delC, c.2332C>G, c.2305A>G, c.2575+2T>C, c.2924C>A, c.3449delA, c.2132G>A, c.3840_3841insTAG, c.865C>T, c.4114C>T, c.813C>A, c.2862_2865delTCCT, c.1846C>T, c.3053C>T, c.3097A>G, c.3731delT, c.1475T>C, c.2356-2A>G, c.3104G>T, c.2071G>A, c.2899A>T, c.3191A>C, c.1340_1343delAAAC, c.3084_3085delGA, c.2755C>G, c.3317T>A, c.654_655delCC, c.3694A>C, c.3829C>T, c.448_452delGAGGG, c.1531C>T, c.343C>T, c.1470C>A, c.2447+2T>A, c.3800A>C, c.1436delC, c.3784G>T, c.3305T>C, c.1968C>A, c.4195delC, c.2804C>T, c.2223T>A, c.2659delG, c.2407G>A, c.2337G>A, c.2304delC, c.1934T>G, c.2695A>T, c.4021G>A, c.2866-6T>G, c.3904-2A>G, c.802_808delTGTAAGT, c.3008C>T, c.3128T>C, c.2333G>A, c.2108G>A, c.4088C>T, c.4112T>C, c.892delC, c.2871delC, c.3796G>A, c.213_214delAT, c.2294A>G, c.2333G>T, c.3263T>A, c.1568T>A, c.3700-2A>T, c.3060+5G>T, c.3190G>A, c.2129G>C, c.3086C>T, c.3532A>G, c.254G>T, c.2623G>A, c.3643G>T, c.3886G>A, c.1186G>T, c.1782delT, c.2762G>A, c.2998G>A, c.2807T>A, c.2532delA, c.2795C>A, c.2121+3A>G, c.2128G>A, c.2438_2440delTAAinsAT, c.2975C>T, c.2572A>G, c.3301G>A, c.3809A>G, c.2621C>T, c.328C>T, c.3443T>C, c.3122G>C, c.561T>A, c.3598C>T, c.2336G>A, c.453delC, c.3111delC, c.3548C>G, c.3007G>A, c.1995G>A, c.1630C>T, c.2123T>C, c.3295G>A, c.845delT, c.2906G>A, c.331C>T, c.2383C>T, c.3722C>T, c.2570T>C, c.3029A>C
Wiskott-Aldrich Syndrome
Condition Gene/Varient
Wiskott-Aldrich Syndrome Gene:WAS. Exons: NM_000377.2:1-12. Variants(4): c.257G>T, c.257G>A, c.244T>C, c.100C>T
Wolcott-Rallison Syndrome
Condition Gene/Varient
Wolcott-Rallison Syndrome Gene:EIF2AK3. Exons: NM_004836.5:2-17. Variants(2): c.1763G>A, c.994G>T
Wolfram Syndrome
Condition Gene/Varient
Wolfram Syndrome Gene:WFS1. Exons: NM_006005.3:2-8. Variants(6): c.676C>T, c.1511C>T, c.1944G>A, c.2084G>T, c.2171C>T, c.2455C>T
Xeroderma Pigmentosum Group A
Condition Gene/Varient
Xeroderma Pigmentosum Group A Gene:XPA. Exons: NM_000380.3:2-6. Variants(4): c.348T>A, c.323G>T, c.619C>T, c.682C>T
Xeroderma Pigmentosum Group B
Condition Gene/Varient
Xeroderma Pigmentosum Group B Gene:ERCC3. Exons: NM_000122.1:2-15. Variants(3): c.1273C>T, c.296T>C, c.1633C>T
Xeroderma Pigmentosum Group D
Condition Gene/Varient
Xeroderma Pigmentosum Group D Gene:ERCC2. Exons: NM_000400.3:2-23. Variants(4): c.1621A>C, c.2047C>T, c.1454T>C, c.2176C>T
Xeroderma Pigmentosum Group E
Condition Gene/Varient
Xeroderma Pigmentosum Group E Gene:DDB2. Exons: NM_000107.2:1-10. Variants(4): c.919G>T, c.937C>T, c.730A>G, c.818G>A
Xeroderma Pigmentosum Group F
Condition Gene/Varient
Xeroderma Pigmentosum Group F Gene:ERCC4. Exons: NM_005236.2:1-11. Variants(4): c.1730dupA, c.2281_2284delTTTG, c.706T>C, c.1765C>T
Xeroderma Pigmentosum Group G
Condition Gene/Varient
Xeroderma Pigmentosum Group G Gene:ERCC5. Exons: NM_000123.3:1-15. Variants(12): c.2620G>A, c.526C>T, c.2170delT, c.215C>A, c.2878G>T, c.2573T>C, c.2972delT, c.1494delA, c.2751delA, c.406C>T, c.787C>T, c.1115_1118delGGAA
X-Linked Adrenal Hypoplasia Congenita
Condition Gene/Varient
X-Linked Adrenal Hypoplasia Congenita Gene:NR0B1. Exons: NM_000475.4:1-2. Variants(22): c.813C>G, c.591C>A, c.788T>A, c.704G>A, c.1319A>T, c.315G>C, c.273C>A, c.513G>A, c.1107G>A, c.1169delA, c.847C>T, c.1316T>G, c.1138T>G, c.388_389delTA, c.873G>C, c.1183C>T, c.800G>C, c.1142T>A, c.109C>T, c.890T>C, c.1146G>T, c.1197C>A
X-Linked Adrenoleukodystrophy
Condition Gene/Varient
X-Linked Adrenoleukodystrophy Gene:ABCD1. Exons: NM_000033.3:1-7,10. Variants(12): c.443A>G, c.1390C>T, c.1451C>G, c.1202G>A, c.1552delC, c.1415_1416delAG, c.1165C>G, c.1252C>T, c.871G>A, c.1552C>T, c.1429G>T, c.796G>A
X-Linked Agammaglobulinemia
Condition Gene/Varient
X-Linked Agammaglobulinemia Gene:BTK. Exons: NM_000061.2:2-19. Variants(28): c.1559G>A, c.1838G>A, c.1082A>G, c.1820C>A, c.1275C>A, c.1685G>C, c.83G>A, c.1223T>C, c.1684C>T, c.43C>T, c.1906G>T, c.1766A>G, c.862C>T, c.763C>T, c.1741T>C, c.1506C>A, c.37C>T, c.1773C>A, c.718G>T, c.755G>A, c.1574G>A, c.1558C>T, c.1288A>G, c.1001A>C, c.338T>A, c.97A>C, c.919A>G, c.2T>C
X-Linked Centronuclear Myopathy
Condition Gene/Varient
X-Linked Centronuclear Myopathy Gene:MTM1. Exons: NM_000252.2:2-15. Variants(4): c.205C>T, c.141_144delAGAA, c.721C>T, c.670C>T
X-linked Charcot-Marie-Tooth disease 5
Condition Gene/Varient
X-linked Charcot-Marie-Tooth disease 5 Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(2): c.344T>C, c.129A>C
X-linked chondrodysplasia punctata 1
Condition Gene/Varient
X-linked chondrodysplasia punctata 1 Gene:ARSE. Exons: NM_000047.2:2-11. Variants(6): c.1743G>A, c.1442C>T, c.1732C>T, c.410G>T, c.119T>G, c.410G>C
X-linked Deafness 1
Condition Gene/Varient
X-linked Deafness 1 Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(4): c.259G>A, c.869T>C, c.916G>A, c.193G>A
X-linked Deafness 2
Condition Gene/Varient
X-linked Deafness 2 Gene:POU3F4. Exons: NM_000307.3:1. Variants(7): c.967C>G, c.990A>T, c.1000A>G, c.499C>T, c.935C>T, c.604A>T, c.950T>G
X-linked Emery-Dreifuss Muscular Dystrophy 1
Condition Gene/Varient
X-linked Emery-Dreifuss Muscular Dystrophy 1 Gene:EMD. Exons: NM_000117.2:1-6. Variants(2): c.631_635delCGTGC, c.547C>A
X-linked Emery-Dreifuss Muscular Dystrophy 6
Condition Gene/Varient
X-linked Emery-Dreifuss Muscular Dystrophy 6 Gene:FHL1. Exons: NM_001449.4:3-7. Variants(4): c.310T>C, c.689-479G>A, c.672C>G, c.625T>C
X-Linked Hyper IgM Syndrome
Condition Gene/Varient
X-Linked Hyper IgM Syndrome Gene:CD40LG. Exons: NM_000074.2:1-5. Variants(9): c.761C>T, c.680G>T, c.107T>G, c.418T>G, c.464T>C, c.632C>A, c.368C>A, c.419G>A, c.703G>C
X-Linked Hypohidrotic Ectodermal Dysplasia
Condition Gene/Varient
X-Linked Hypohidrotic Ectodermal Dysplasia Gene:EDA. Exons: NM_001399.4:1-2,4-8. Variants(9): c.466C>T, c.206G>T, c.826C>T, c.183C>G, c.467G>A, c.463C>T, c.1045G>A, c.725delG, c.573_574insT
X-linked Infantile Spasm Syndrome 1
Condition Gene/Varient
X-linked Infantile Spasm Syndrome 1 Gene:ARX. Exons: NM_139058.2:1,3,5. Variants(2): c.1058C>T, c.81C>G
X-Linked Infantile Spinal Muscular Atrophy
Condition Gene/Varient
X-Linked Infantile Spinal Muscular Atrophy Gene:UBA1. Exons: NM_003334.3:2-26. Variants(3): c.1617G>T, c.1639A>G, c.1731C>T
X-Linked Juvenile Retinoschisis
Condition Gene/Varient
X-Linked Juvenile Retinoschisis Gene:RS1. Exons: NM_000330.3:1-6. Variants(3): c.221G>T, c.214G>C, c.325G>C
X-Linked Leigh Syndrome
Condition Gene/Varient
X-Linked Leigh Syndrome Gene:PDHA1. Exons: NM_000284.3:2-11. Variants(2): c.773A>C, c.787C>G
X-Linked Lymphoproliferative syndrome 1
Condition Gene/Varient
X-Linked Lymphoproliferative syndrome 1 Gene:SH2D1A. Exons: NM_002351.4:1-4. Variants(8): c.95G>C, c.302C>T, c.385T>A, c.172C>T, c.203C>T, c.163C>T, c.164G>T, c.3G>T
X-Linked Ocular Albinism
Condition Gene/Varient
X-Linked Ocular Albinism Gene:GPR143. Exons: NM_000273.2:2-9. Variants(6): c.397T>A, c.695C>A, c.397T>C, c.455G>A, c.992_993insCG, c.816_829delGCAAACAGATATCA
X-Linked Severe Combined Immunodeficiency
Condition Gene/Varient
X-Linked Severe Combined Immunodeficiency Gene:IL2RG. Exons: NM_000206.2:1-8. Variants(10): c.458T>A, c.452T>C, c.923C>A, c.454+1G>A, c.343T>C, c.854G>A, c.865C>T, c.186T>A, c.664C>T, c.355A>T
X-Linked Severe Congenital Neutropenia
Condition Gene/Varient
X-Linked Severe Congenital Neutropenia Gene:WAS. Exons: NM_000377.2:1-12. Variants(3): c.809T>C, c.814T>C, c.881T>C
X-linked Sideroblastic Anemia and Ataxia
Condition Gene/Varient
X-linked Sideroblastic Anemia and Ataxia Gene:ABCB7. Exons: NM_004299.3:1-16. Variants(3): c.1203T>G, c.1234G>C, c.1300G>A
X-linked Sideroblastic Anemia
Condition Gene/Varient
X-linked Sideroblastic Anemia Gene:ALAS2. Exons: NM_000032.4:2-11. Variants(4): c.1354C>T, c.569A>T, c.1427T>A, c.1163C>G
X-Linked Spastic Paraplegia 2
Condition Gene/Varient
X-Linked Spastic Paraplegia 2 Gene:PLP1. Exons: NM_000533.3:1-7. Variants(1): c.409C> T
X-linked Thrombocytopenia
Condition Gene/Varient
X-linked Thrombocytopenia Gene:WAS. Exons: NM_000377.2:1-12. Variants(4): c.1442T>A, c.173C>G, c.167C>T, c.134C>T
2 Variants of g roup B Acyl-CoA Dehydrogenase Deficiency,Short-Chain
Condition Gene/Varient
2 Variants of g roup B Acyl-CoA Dehydrogenase Deficiency,Short-Chain Gene:ACADS. Exons: NM_000017.2:2-10. Variants(1): c.319C>T
Yunis-Varon syndrome
Condition Gene/Varient
Yunis-Varon syndrome Gene:FIG4. Exons: NM_014845.5:1-23. Variants(3): c.1260_1261delGT, c.311G>A, c.831_838delTAAATTTG
Alpha1-Antitrypsin Deficiency
Condition Gene/Varient
Alpha1-Antitrypsin Deficiency Gene:SERPINA1. Exons: NM_000295.4:2-5. Variants(9): c.839A>T, c.347T>A, c.272G>A, c.230C>T, c.194T>C, c.863A>T, c.1096G>A, c.187C>T, c.415G>A
Ataxia With Vitamin E Deficiency
Condition Gene/Varient
Ataxia With Vitamin E Deficiency Gene:TTPA. Exons: NM_000370.3:2-5. Variants(1): c.575G>A
Autosomal Recessive Deafness 1A
Condition Gene/Varient
Autosomal Recessive Deafness 1A Gene:GJB2. Exons: NM_004004.5:2. Variants(4): c.520T>C, c.535G>C, c.551G>A, c.101T>C
Autosomal Recessive Polycystic Kidney Disease
Condition Gene/Varient
Autosomal Recessive Polycystic Kidney Disease Gene:PKHD1. Exons: NM_138694.3:2-67. Variants(3): c.10926G>A, c.5125C>T, c.8581A>G
Beta-thalassemia
Condition Gene/Varient
Beta-thalassemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(17):c.-50-u101C>T, c.-50-u88C>T, c.102_104delGGT, c.182T>A, c.295G>A, c.315+4_315+5delAG, c.315delG, c.316-125A>G, c.316-238C>T, c.316-8T>G, c.344T>C, c.364G>T, c.378_379insCCA, c.382C>T, c.383A>C, c.86T>G, c.92_94dupGGC
Canavan Disease
Condition Gene/Varient
Beta-thalassemia Gene:ASPA. Exons: NM_000049.2:1-6. Variants(2): c.212G>A, c.863A>G Choroideremia. Gene:CHM. Exons: NM_000390.2:1-15. Variants(2): c.1609+1_1609+2insT, c.1609+2_1609+3insT
Duchenne Muscular Dystrophy
Condition Gene/Varient
Duchenne Muscular Dystrophy Gene:DMD. Exons: NM_004006.2:1-79. Variants(1): c.1934A>
G Factor V Leiden thrombophilia
Condition Gene/Varient
G Factor V Leiden thrombophilia Gene:F5. Exons: NM_000130.4:1-25. Variants(1): c.1601G>A
Factor XI Deficiency
Condition Gene/Varient
Factor XI Deficiency Gene:F11. Exons: NM_000128.3:2-15. Variants(6): c.166T>C, c.809A>T, c.901T>C, c.438C>A, c.1716+1G>A, c.403G>T
Familial Mediterranean Fever
Condition Gene/Varient
Familial Mediterranean Fever Gene:MEFV. Exons: NM_000243.2:1-10. Variants(1): c.2084A>G
GLDC-Related Glycine Encephalopathy
Condition Gene/Varient
GLDC-Related Glycine Encephalopathy Gene:GLDC. Exons: NM_000170.2:2-25. Variants(1): c.2405C>T
Glycogen Storage Disease Type II
Condition Gene/Varient
Glycogen Storage Disease Type II Gene:GAA. Exons: NM_000152.3:2-20. Variants(1): c.-32-13T>G
Glycogen Storage Disease Type V
Condition Gene/Varient
Glycogen Storage Disease Type V Gene:PYGM. Exons: NM_005609.2:1-20. Variants(13): c.613G>A, c.2128_2130delTTC, c.1628A>C, c.1621G>T, c.2392T>C, c.1827G>A, c.1094C>T, c.1963G>A, c.255C>A, c.1722T>G, c.148C>T, c.1726C>T, c.1A>G
Hemophilia A
Condition Gene/Varient
Hemophilia A Gene:F8. Exons: NM_000132.3:1-26. Variants(80): c.1660A>G, c.5944T>A, c.6658_6660delGCC, c.6301C>G, c.2059C>T, c.289G>C, c.6658G>C, c.1748A>G, c.5302C>T, c.2225A>G, c.6104T>C, c.2138A>T, c.5422C>T, c.5123G>A, c.5918A>T, c.6533G>A, c.6955C>T, c.1649G>A, c.6790A>G, c.1910A>G, c.979C>G, c.5218A>G, c.6278A>G, c.6113A>G, c.842C>A, c.908C>A, c.5305G>C, c.6021G>A, c.6067G>A, c.5938C>G, c.6532C>T, c.1018G>A, c.1688C>G, c.6920A>C, c.5329C>T, c.1589A>G, c.655G>A, c.6685C>T, c.1679G>C, c.896A>T, c.1992G>C, c.6622C>G, c.1733T>C, c.1280A>T, c.2043G>A, c.6371A>G, c.5093T>C, c.1700T>C, c.5303G>A, c.5305G>A, c.6575G>T, c.669A>T, c.2215G>A, c.1094A>G, c.871G>A, c.5180A>T, c.1736A>C, c.6214C>T, c.5900G>A, c.1930T>G, c.6089G>A, c.1730C>T, c.5954G>A, c.396A>C, c.5558C>T, c.1834C>T, c.2128G>T, c.6956C>T, c.446C>G, c.338A>G, c.1372C>T, c.1309C>T, c.361G>A, c.6932C>A, c.5143C>G, c.6119G>A, c.1648C>T, c.5096A>T, c.5501A>G, c.6787_6788insTTG
Hemophilia B
Condition Gene/Varient
Hemophilia B Gene:F9. Exons: NM_000133.3:1-8. Variants(14): c.391+7A>G, c.1159A>G, c.271T>A, c.1291T>A, c.19A>T, c.793G>A, c.1061G>A, c.1001T>C, c.1298A>C, c.797C>T, c.1265C>A, c.1345C>T, c.1015A>G, c.1009G>A
HFE-Related Hereditary Hemochromatosis
Condition Gene/Varient
HFE-Related Hereditary Hemochromatosis Gene:HFE. Exons: NM_000410.3:1-6. Variants(3): c.845G>A, c.187C>G, c.848A>C
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency
Condition Gene/Varient
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency Gene:CBS. Exons: NM_000071.2:3-17. Variants(1): c.1105C>T
Macular degeneration, juvenile
Macular degeneration, juvenile Gene:CNGB3. Exons: NM_019098.4:1-18. Variants(2): c.1208G>A, c.1148delC
MTHFR deficiency
Condition Gene/Varient
MTHFR deficiency Gene:MTHFR. Exons: NM_005957.4:2-12. Variants(1): c.665C>T
Nephropathic Cystinosis
Condition Gene/Varient
Nephropathic Cystinosis Gene:CTNS. Exons: NM_004937.2:3-12. Variants(1): c.124G>A
Oculocutaneous Albinism Type 2
Condition Gene/Varient
Oculocutaneous Albinism Type 2 Gene:OCA2. Exons: NM_000275.2:2-24. Variants(1): c.1441G> A
Odontoonychodermal Dysplasia
Condition Gene/Varient
Odontoonychodermal Dysplasia Gene:WNT10A. Exons: NM_025216.2:1-3. Variants(1): c.682T>A
Phenylketonuria
Condition Gene/Varient
Phenylketonuria Gene:PAH. Exons: NM_000277.1:1-13. Variants(24): c.799C>G, c.1256A>G, c.965C>G, c.1241A>G, c.175G>T, c.205C>T, c.307G>A, c.428A>G, c.839A>C, c.365C>A, c.1194A>C, c.1162G>A, c.1117G>A, c.877T>A, c.155T>C, c.512G>C, c.937G>A, c.434A>T, c.1223G>A, c.1139C>T, c.386A>G, c.281T>G, c.1208C>T, c.158G>A
Protein C deficiency
Condition Gene/Varient
Protein C deficiency Gene:PROC. Exons: NM_000312.3:2-9. Variants(6): c.629C>T, c.1335C>G, c.866C>T, c.1000G>A, c.793C>T, c.902C>T
Protein S deficiency
Condition Gene/Varient
Protein S deficiency Gene:PROS1. Exons: NM_000313.3:1-5,8-10,12,14. Variants(2): c.701A>G, c.835C>T
Pseudocholinesterase deficiency
Condition Gene/Varient
Pseudocholinesterase deficiency Gene:BCHE. Exons: NM_000055.2:2-4. Variants(1): c.293A>G
Smith-Lemli-Opitz syndrome
Condition Gene/Varient
Smith-Lemli-Opitz syndrome Gene:DHCR7. Exons: NM_001360.2:3-9. Variants(1): c.1A>
G Stargardt Disease 1
Condition Gene/Varient
G Stargardt Disease 1 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(27): c.5693G>A, c.5912T>G, c.6320G>A, c.3113C>T, c.6088C>T, c.3322C>T, c.1018T>G, c.1225delA, c.5882G>A, c.5338C>G, c.5908C>T, c.6079C>T, c.2588G>C, c.634C>T, c.3210_3211dupGT, c.5819T>C, c.52C>T, c.3083C>T, c.3106G>A, c.4139C>T, c.1715G>A, c.3364G>A, c.571-2A>G, c.2565G>A, c.3386G>T, c.6148G>C, c.2791G>A
Tay-Sachs pseudodeficiency Disease
Condition Gene/Varient
Tay-Sachs pseudodeficiency Disease Gene:HEXA. Exons: NM_000520.4:1-14. Variants(2): c.745C>T, c.739C>T
TFR2-Related Hereditary Hemochromatosis
Condition Gene/Varient
TFR2-Related Hereditary Hemochromatosis Gene:TFR2. Exons: NM_003227.3:1-18. Variants(14): c.1330G>A, c.750C>G, c.949C>T, c.1469T>G, c.1665delC, c.1861_1872delGCCGTGGCCCAG, c.1186C>T, c.2137-1G>A, c.88_89insC, c.515T>A, c.2069A>C, c.1235_1237delACA, c.2374G>A, c.313C>T
Usher Syndrome Type 1D
Condition Gene/Varient
Usher Syndrome Type 1D Gene:CDH23. Exons: NM_022124.5:2-70. Variants(1): c.5237G>A
Venous Thromboembolism
Condition Gene/Varient
Venous Thromboembolism Gene:F2. Exons: NM_000506.3:1-14. Variants(1): c.*97G>A Xeroderma Pigmentosum Group G. Gene:ERCC5. Exons: NM_000123.3:1-15. Variants(1): c.2375C>T